Basic Information

Symbol
DZIP3
RNA class
mRNA
Alias
DAZ Interacting Zinc Finger Protein 3 HRUL138 PPP1R66 Human RNA-Binding Ubiquitin Ligase Of 138 KDa Protein Phosphatase 1, Regulatory Subunit 66 RING-Type E3 Ubiquitin Transferase DZIP3 RNA-Binding Ubiquitin Ligase Of 138 KDa DAZ Interacting Protein 3, Zinc Finger E3 Ubiquitin-Protein Ligase DZIP3 DAZ-Interacting Protein 3 RNA-Binding RING-H2 Protein-Ubiquitin Ligase Zinc Finger DAZ Interacting Protein 3 UURF2 Ubiquitin Ligase EC 2.3.2.27 KIAA0675 UURF2
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Drug abuse diagnoses

MANE select

Transcript ID
NM_014648.4
Sequence length
5304.0 nt
GC content
0.3888

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1303.72 kcal/mol
Thermodynamic ensemble
Free energy: -1405.48 kcal/mol
Frequency: 0.0000
Diversity: 1495.73
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((..((((((.........))))))...((.(((((((.....(((((((((............)).)))))))...(((........))).(((((((.(((.(.((((.((((........)).)).)))).).).))..)))))))......(((((.(((((....))))).)))))((((((.((((((((.((.(((......))).)))))).))))))))))))))))).)).(((((((((((.((((((((..((((((.......))))))..........((((((.....((((.............))))))))))....((((......)))).(((.((.(((((......)))))))))).......(((((((....))))))).....))))))......)).))))))))))).....(((.((((.((((((((((......(((....(((((.(((((((((((((((((((.((((..((((((((((....(((((.(((....(......)....))).)))))((.........))....((((((((...((((((((.((((...(((((.(........).)))))..(((.......)))..........(((((((.((...(((.((((.....)))))))........)))))))))......(((((((((..(....(((((((((((.......((((((((((.((.....)).)))).).)))))))))))))...))).....)..))))))))).....(((.(((....)))))).))))))))))))))))))))....(((((....(((((.((.((......)).)).)))))...))))).............))))))).)))..))))))........))))))((((((((........))))))))))))).((((((((.(((((((((((((((((..((........))...))))))))..))))).))))..(((((..((..(((.((((((..........)))))))))..))..)))))..((((.((..((((....((((.((((((((((((((..((((((((..((((((((.(((.((((.(.((.((..((((((.(((((((.(.(((((.((((.((.(((....((((.((((((.((((....((((((.(((((((...((((...(((((((.(((.((.....)).)))...)).)))))...(((((((.((.............)))))))))................(((((.......)))))))))...))).)))).))))))...))))..)))))).))))))).)).)))))))))).))))))).............((((((((.((((((....(((((((...))))))).(((((......)))))((((.(((....))).)))).((((((..(((.......)))...))))))....))))))..))))))))(((((....))))).....)).))))..)).)).).)))).))).))))......))))...))))))))....((.((((((((((((......))..((((.((((.....)))).))))......(((((((.((((..(((((((((...(((((.....(((((((((...((((((((((((.........))))))))))))......(((((......)))))...........))))))))).)))))))))))))).))))((((((((((((...(((.(((((((.((.......))...))).)))).)))....)))).))))).))).(((..((((.(((((........((((((((((((.....((((..........)))).....((((...(((((...(.((.....)).))))))..))))..((((((((((.((((...........(.((((.......)))).)..........((((....))))..(((((.....((((((...............((((.........))))((...((((((((.....(((((.....((((((.(.......((((...........................................)))).......(((...))).....).))).))).....)))))..))))))))....))..)))))).....))))).....((((((.((((....(((((((((((((((((((.((((..((.(((((((((...((((........))))...(((((((((.((((((((...((((...)))).(((((...((((....(((.((((((((((..(((..(((.((((((.((.(......))))))))).....(((((((...)))))))........(((.((((((((.((((.(((.(((((..((((................((((((..(((..((........))...))).))))))...(((((((((((........((((((((.........(((((.......)))))...(((......)))..))))))))))))))))))).........(((.((...((((..(((......)))....((((.......(((....)))......((((((((...((........))...(((.....)))..((((((.......((((((..((((((.(((((((((((((......)))))))))))))((((((((((..(((.(((.((((..(((...))).)))))))..(((.(((..(((.......)))..))).)))))))))))...(((((((..((((..(........)..))))....)))))))...((((.((......))...................((((((((((.....)))).)))))).....))))...)))))..............((((((((.((((......)))))))))))).....(((...(((((...)))))...)))))).))).)))))).......)))))).))))))))..((((.(((.(((((((.(((((......(((((((.....(((.....))).....)))))))))))).(((((((((((.(.....).)))))...)))))).))))))))))))))))))(((((((((((((((...((.(((((((((........)))((((((.((((..((.....))..(((.(((.(((((...)))))))))))..))))..))))))(((..((((......))))...))).....)))))).))..)))))))))))).))).))))...)))))....))))..)))))))).)))....).)))))))).)))..)))..)))))))))))...)).))).))))..)))))((((......(.((((((((.......)))).)))).).(((...(((((((.(((((..((((..((((...(((((((((.((...(((..((((((........))))))..))).)))))......))))))...))))..)))))))).)...)))))))..)))((((((((.......))))))))...)))).)))))))).......((((((...(((((((((........((((((((.....))))..(((....)))....(((((((....((((..((((((((((((.....(((((....)))))((((.((.(((((((((((((((((((((((....(((((((((((......(((......))).....))))))))))).......(((((((((.((........)))))))))))..(((((((.(......)))))))).((((.((((.......)))).)))).)))))))))............)))))))))))))).))...))))..))))))))))))......((((((........))))))...........))))...)))))))....)))))))))))))...))))))))))))))).............(((((((....))))))).)))))))))))...)))))))))))....))))))))))))..(.(((((....))))).))))).))))))((((((((((((((((.((((((((((((((..((((((......))))))..)))))((((((.((((......)))).((((.((........))..)))))))))).....(((((((....((((.........))))...))))))).(((...((((((((.((.(((((....(((((((((.((((((.(((((.....))))).)))..)))....)))))..))))....)))))))))))))))....)))((((((........))))))...........))))))))).)))))))...(((((((.........)).))))).......)))))))))((((((((....))))))))))))...))))))))))((((((...)))))))))))))).))))......)))))...))))..)))...................(((((((..(((((((((..............))))).))))))))).))))))))).......(((((((...((.((((((((.((((((((((...(((((.(((((...((((.....)).))....))))).)))))....))))........))))......(((((...(((((......((....))((((..((.......))..)))).....)))))))))).(((((.....)))))...)))))))))).))))).))))))))))))))))))))))...))))))..)).))))))))..))..)))).))))))))....((((((...........))))))........))))))))))))))..((((((.............)))))).(((((((((.((((.((..(((.((..(((...................)))..)))))...)).)))).)))))))))((((....))))...(((....))).....)))))))))).)))))))......(((((.......)))))..)))).
Thermodynamic Ensemble Prediction
..(((({,((((((.........)})))),{{((((((((((.....(((((((((,..........,}}.)}))))),,,(((........))).(((((((.{{.,.,({((.((((........)).)).)))}.}},,})..)))))))......(((((.(((((....))))).)))))((((((.((((((((.{{,(((......,)),)})))).)))))))))))))))))..),||||((((({{.{{{{{,,,..{(((((.......}))))}..........((((((.....((((........,....))))))))))....((({......}))}.(({{({{(((((......}))))))))),{{....|||((({....,)))}}}.....}))))),...,,,),))))))))))).....,{|,{({{.((((((((((......(((....(((((.(((((({((((((({{,{{.(({{..(((((((({,....{{{{{.|||,,,,|....,})},,,}}}.|||}|({,,,,.,,,.||{{,.{({{{{{{...{(((((((,((({.{,{{,((.({({,....,{{({,..}|||..,,,,,})),.........{{{(({{.({...{||,{{{{.....))))})),,},.,,,}}))))})),,....(((((((((,,(....((((((((((({..,,..{(((({((((.((.....)).)))).},}}}}})))))))),,,})),....)..)))))))))....,{{{,(((,,..}|||,,.}}},}}}}|||}}}))))}}....(((((....(((((.((.((......)).)).))))}...)))))|{{,.,,,....,)),)))).|||{{|}}||,.......,.,})}}{((({{({,,,,,.,.,||||||}...}}}}|||||||,|||{{{{{{{(((((((..((........))...))))))))..}})))})|))|..|||}}}||,||||.{(((((,,,...,},.)))))}.,,,,,,..}}}}}..((((.((..((((....((((.({((((((((((((..((((((((..((((((((.({(,((((,,,{({((..((((((.(((((((.(.(((((.((((,,{.{{{....((((.((((((.((((...,((((((.(((((((...((((,..{{({(({{{{,,(({....,,.,)),,.,)})),,}...{((((((.((.............)))))))))................{{{{{......,)))})))))...)))},))).)))))),,.))))..)))))).))))))).})}))),)))))).))))))).............((((((((.((((({....(((((({...})))))).{((((......))))}{(((.(((....))).)))}.((({{{..||{.......}}}...))))))....))))))..))))))))(((((....))))).....))},)))..}}.,,.}.)))).))).)))),,....))))...))))))))....,,.(((((((((({{......||,{((((.((((.....)))).)))}..,,,,((({{{{.((((..(((((((((..,(((((.....{((((({((,,.((((((((((((.{.....}.))))))))))))...,..,{(((......}})||,.....,}}},)))}}}}}}.))}}}))))))))).))))|||||{{{{{{{...{((,{{(({{{,||,,...|,||...)))),,}},}}}....)))},}}}}}.}}}.(((..((((.(((((.,......((((((((((((.,,..((((..........))))...||((({...(((((,.,..{{.....)),))))))..}})}..((((((((((.((((..,..,,,{{.{,{{{.{(((((.{.{{.{{{{,......((((....))))..((((((((((({(((((((({..........((((.........)))},,,,.{(({{,,,.|,.,{{{{,..,..(((((({{{.{{||||||,...,.,{{{{,.,,,,{{{,{,.,...........,........,||.......{{{.,.|||{{...,,|||{{{{,..{{{{{{{{.{|{||||,...,||..|||,{|{,...,,.{(((....|}}|,......,},{{|||{{{|{{|{{{{{{{.{{{{,,|{|,(((((({{,,.{||||,,.,|,,||{|,..||{|{|{{||{{{{(((((({(((((((((((.(((((,..{((,....{{{.{{{(((((({.,(((..(({.((((({{(({{......))))))))).....{((((((...)))))}}.,.,{{{,{,,.{({{{(((,{{{{,(({{((((({{{(({.......,,...,{,.((((({..{({..((........))...)}).))))))...{((((((((((,,,..,..{{{{({{{|........(((((.......)))))...{{|...,..)))..}}}}}}}}))))))))))|{{{,{{{..,,,.,|}..||||,.(((......)}}...||{||,,||,,.{{{....,,,.,||..((((((((...(({.......{{{{.{((,,..,|}}.{{(({||..{{{{{((.,,,..}|}|||}(((((((((((((......))))))))))))},(({,{{,,,,,,,,.(({{((((..(((...))).)))))))..(((.(((..{{{.......}}}..))).))){{..|{,|{{{(({.((({{,,,|}}|,..{{{,.,..}}}.,,},)))))}},..{||{.,.||....|,..............,},..(((((({{{{,...,)))).)))))).....,))),}|||||||,,|{.........((((((((.((((......))))))))))))..,,.||{,..{((((,..}}))),,.}}}|||...,..|||||,.......})}..,))))}})}..|||,.(((,((((({{,(((((.....,(((((((..,,.{((.....))),}...))))))))||||,({(({{{{{||.||},,.)}}|||||,,|||||},||}|||||||}}||||||.,{((((((((((((...(,.(((((((((........))){(((({.{(({..{{....,))..{{{.{,(((((((...)))))))}}})|.}})}..})))},|||..{(((......)))|,,,|||.....}))))).}}..)))))))))))}},||,.,,,....}})}..},)))}.}))}},})},})),,.,),))}})))}.))),.))).,))))))))}}}...}}.})).})))}.},}}}.|||,....,,...|||||}....}},}}}}.}}||.{|||}||,}.}}))}}))}})),}}..,,{}}|,,,))}.}}}}},}.....))))}))))....)))))))))}},,},},}}))))},...)))))).,}))))})}||}||},......,,|||||{|.,((((((({,{....})))))))),}..)))})}})}},,..,{{{{((((((...(((((((((........{{{{((((.....}}))..(((....)))....(((((((.,..((({..((((((((((((.....(((((....)))))((((.({.(((((((((((((((((((((((.,,,(((((((((((...,..(({......))).....)))))))))))....,{.(((((((((.{{........}}))))))))),}(((((((.(......}))))))).{(((.((((......})))}.)))).)))))))))............)))))))))))))).})...))))..))))))))))))......((((((.,......))))))...........)))).}.))))))).,,.))}})))))))))...))))))..,,)))}..............(((((({....})))))).)))))),})}.,,,,))))))}})).,,,})),}}})),))})}}|||......))))))).....}}}.))))||)))))),,.|}))||},|,}})}}},...{(((((......)))))).,||||,{{{{{{.((((......))))}||||.||,},.....}}..}}}}}}}}}}.}}},(((((((....((((.........))))...))))))).(((...((((((((.((.(((({..,.(((((((((.((({((.(((((.....))))).)))..)))....))))),.,))).,..}))))))))))))))....)))((((((........))))))..{(((((((((({..{(((({{(({,....(((((((.........)).)))))....}))))}))))).....})))))))))))....))))...)))))))))){(((({...)))))})))))))),,))).....,)))))...))))..)))................}}}||{{{((..(((((((((..............)))))}})))})))).},,)))}}}.......(((((((,..((.((((((((.((,,{(((((...(((((.(((((.(.((((.....)).))....))))).)))))....)))),.......||||,.....|||||...,(((({({{{{.,.,{{..,|||,.,..}}}}.}))}})}||.....,,,)),}}}}.(((((.....)))))...)))))))))).))))).))))))))))))))}}))))))...))))))..)).))))))))..))..)))),|||||,|,...{((,((,.....}}}}}.})))))},......})))))))))))))..((((((.............)))))).(((((((((.((((.((..(((.((..(((...................)))..)))))...)).)))).))))))))),,,{....}}}}...,{{....,},.....)))))))))).}))}||},|||..{{{{{.......))))}...})).

Transcripts

ID Sequence Length GC content
ACUCAGCUGUGCGCUCUGAUUUCGUGCGCUUCCUCGUCCUUCAUGUUGG… 5304 nt 0.3888
Summary

Enables several functions, including phosphatase binding activity; polyubiquitin modification-dependent protein binding activity; and ubiquitin-protein transferase activity. Involved in protein polyubiquitination. Located in cytoplasm. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in humans identified the DZIP3 as a hub gene significantly downregulated in heart failure patients and capable of predicting heart failure progression post-myocardial infarction, with a 10-gene panel including this biomarker achieving an AUC of 0.926 in test cohorts [Xu et al. DOI:10.3389/fgene.2025.1592985]. In mice selectively bred for methamphetamine consumption, the DZIP3 was identified as a network hub node with differing connectivity between high- and low-risk lines in the ventral midbrain, where it was overexpressed in the high-drinking line [Hitzemann et al. DOI:10.3390/brainsci9070155].