Basic Information

Symbol
E2F1
RNA class
mRNA
Alias
E2F Transcription Factor 1 RBBP3 RBP3 Retinoblastoma-Binding Protein 3 (E2F-Like) Retinoblastoma-Associated Protein 1 Retinoblastoma-Binding Protein 3 Transcription Factor E2F1 PRB-Binding Protein E2F-1 RBAP-1 RBBP-3 E2F-1 PBR3 RBAP1
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_005225.3
Sequence length
2690.0 nt
GC content
0.6164

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1205.00 kcal/mol
Thermodynamic ensemble
Free energy: -1248.93 kcal/mol
Frequency: 0.0000
Diversity: 716.56
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.(((((.(((.((((((((((((((((..(((((.(((.((....)))))..))))))))).....)))).)))))))).)))(((((.....))))).((((((((((((.((((..(((....(((((((((.(((((((((((((((.((((((((((.((.(((......))).)))))))))))))).))))))..........((((...((((............((((((..(((.(((...))).))).......((((..(((((....))))).))))))))))....))))...))))...........))))))).))))))))).....)))..))))))))))))))))(((((((.(((((((....((((.(((((((((((((.(((((...)))))..((((((.(......).))))))...(((((....))).)).))))))....(((((((..((((...))))....)))))))...(((...(.(((..((((..((((.((((((((..(((((.((((((...))))))(((((....))))).((......))))).))))))))))...))))))))..))).)..)))..............((((....)))).)))))).).))))......(((((.(..((((.....)))))))))).(((.(((....)))))).))))))).)))).)))(((.....)))((((((...((((((....((((((((.((.(((((((........(((....))).........))))))))).))))))))(((((..(((((..((((.((((((((((...((((((((((((.......(.((..((((.....(((((((.(.(((....(((((((((((.((.(((((.(...(((((....(((.((((((....(((((.((...)).)))))....((((((.....(((((......(((((((((....(((.(((((.((......))((((...(((((((........))))))).)))).))))).)))))))))))))))))..)).))))..(((....))).((((.((((((((.(((((((((((((((((((((.(((...((...((((.(((..((((..(((.((((((((.(((.((((((...(((((.((((....)))))))))))))))(((((.(((((((.((((((.(((.......((((((((((.((((..((((((((((......(((((((((...)))))).......((((((.(((.((...(((((((...............))))))).)).))).)))))).(((((((((...((......))....((((........)))).)).)))))))(((((...((.(((.((((((((..(((((((.........))))))).))))))))..)))))...)))))))))))))))).)).((((....))))............((((.((((....(((((((.(((...))))))))))((((((....)))))).((((.....))))))))))))........(((((((.(((((.(.((.....))))))))))))))).)))).))))))))))((((((....))))))((((.(((((((((((.(((.....((((......))))))).)).))))).)))).)))))))))))))...((.((((((((((((((....))))))))))))))))((((((..((......))..)))))).((((((.((((((((.(((..((((((..((((((((.(((((....((((((......))))))...)).))).))))....)))).)))))).))).))))(((((((((.((((....((((((.(((.........))).)))))).)))).))).))))))........((((((((.(((.((...))..))).)))))))).((((((((.((((((....)))))))).)))))).)))).))))))))))))))))))...))).)))))..))).)))..)))).))))))).)).))))))))..........))))...)))))).)))))).........((((.(((...))).))))))))))))))))(((((((....))))))))))))).)))...)))))...).))))).))...((((((.((((.((((((.((((((((..((..(.(.(((((..(.((((.(((....))).))))).))))).))..)).))))))))))((((((...((.((....)).))..)))))).......)))))))).)))).)))))))).)))))..))).).)))))))......))))..)).)...........))))))).))))))))))))))).))))......((((((.((......((((((((((((....((..(.(((((((.......))))))))..)))))))))).)))))).))))))((..((((((........))))))..)).)))))..)))))))))))..)))))).........))))))))......(((((((......)))))))..
Thermodynamic Ensemble Prediction
.(((.(((((.(((.(((((((((((((((({.{((((.(((.((....)))))..))))))))).....)))).)))))))).)))(((((.....))))).((((((((((((.((((..(((....(((((((((.(((((((((((((((.((((((((((.((.(((......))).)})))))))))))).))))))..,,......((((...((((,,......(((((((.((.((((.(((....(((((......)))))..))))))),),)}))}})))....}.))...)))).,,)}}}.....,.....))))))).))))))))).....)))..)))))))))))))))){{(((((.(((((({....((({.(((((({((((((.(((((...)))))..((((((.(......).))))))...(((((....))).)).))))))....(((((((..((((...))))....)))))))..,{,,..||,(((..((((,{(,,{.{(((((({..({(((,((((((,,.}}}))){((((....))))|.{{.....,|}|||.|,}}}|}||},..)))})}}}..))),,},}},.,|,,..,,,,...|||{.,,,))}).}))))),}.}}))......(((({.{..((((.....)))))))))).{((.({{....)))))).})))))).))))}|||(((,....)))((((((...((((((....((((((((.((.(((((((........(((....))).,.......))))))))).))))))))(((((..(((((..((((.((((((((((...((((((((((((,{.{,.,,{(,,{((((...}}||||,||.|,,||||.,{{,((((((((,{({(((((.(...(((((....{{{.{{{{(({{{.(((((.({...}).)))))...}||||,......(((((.,,,.,(({((((((....{{{.||||||{|}}.}}}|}|,,|.,,|{(((({.,..,,}.))})))),)},,.})))),||||||}||||||||||..||,|}||,.{{{...,)}),((((.((((((((.(((((((((((((((({{{{{.{((..,((,,,((((.(((..((((..(((.((((((((.(((.((((((...(((((.((((....)))))))))))))))(((((.(((((((..((((((({,{{{,({.{(.(((({({({....,{|}|||||,...}}})}))}{{(((,..)))))),})))))))..(((((((,,((({(((((({((((......(((((.((((...)))).))))).,{((((((((((....({{.{{{.{{{{((((......,})))}.||....},,.(((((,..((.(({.((((((((..((((((({.......,))))))).))))))))..))))).}.)))))(((((((((((((((.(({,{,..,||............((((.((((....((((((,,(((...)))))))))){(((((....)))))}.((((.....))))))))))))..||,,.,{((((((.(((((.(.((.....))})))))))))))).}..,.}}|(((,((((.(((({,{{({..{(((((.(((((((((((.(({....,((((......))))))).)).))))).)))).)))))|((({.,{{{{{({(((({({,,{{{{{....)))))),)))))))))}||))})..},.}))).)))),)))).,(((((((((...,{,....}})))))))))}.((((.(((((....((((((......)))))).,.)).))).))))...})).))))))).....)))))))).|}}}}}}..,.)))..,.)))}}...)))))}.||.{||||...})))).,,.........))))))))))..,}),).)..)))))))...((..(((((.(((((((,.((((((....))))))}),)))))).)))))..))..))))))))))))...))).)))))..))).)))..))))})),)))).)).))))))))..........))))...)))))).)))))).....,..{((((.{((...))),))))))))))))))))(((((((....)))))))})}))),)))...})))).,.},)}))).))...,{((((.((((.((((((,((((({{{..((,.,.,,||(((.{(.((((.(((....))).))))).})}||,||.,||,||}}}}})))||||{|,,,|{.{{.,,,)),)),,))))}}.......)))))))).}))).}}}}})}}},}})}..}}}.},)))))))}},,,})))),,))})}...,......,}))))).))))))))))))))).))))...,{.{{{{||..{,...,{((((((((((((....((..(.(((((((.......))))))))..}))))))))).}))))},)))))},|,.((((((........))))))..,,.)))))..)))))))))))..))))))....,....))))))))......(((((((......)))))))..

Transcripts

ID Sequence Length GC content
GGGACUUUGCAGGCAGCGGCGGCCGGGGGCGGAGCGGGAUCGAGCCCUC… 2690 nt 0.6164
Summary

The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the E2F1 was upregulated in common in splenocytes at day 7 post-injury following both burn and trauma-hemorrhage, where it was identified as a gene expression marker within the Cell Cycle Control pathway [Lederer et al. DOI:10.1152/physiolgenomics.00086.2007]. In human heart failure patients, research found the E2F1 was upregulated in peripheral blood mononuclear cells from those with sacubitril/valsartan resistance compared to non-resistant patients after acute myocardial infarction [Su et al. DOI:10.1016/j.ejphar.2023.175547].