| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGACUUUGCAGGCAGCGGCGGCCGGGGGCGGAGCGGGAUCGAGCCCUC… | 2690 nt | 0.6164 |
The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the E2F1 was upregulated in common in splenocytes at day 7 post-injury following both burn and trauma-hemorrhage, where it was identified as a gene expression marker within the Cell Cycle Control pathway [Lederer et al. DOI:10.1152/physiolgenomics.00086.2007]. In human heart failure patients, research found the E2F1 was upregulated in peripheral blood mononuclear cells from those with sacubitril/valsartan resistance compared to non-resistant patients after acute myocardial infarction [Su et al. DOI:10.1016/j.ejphar.2023.175547].