Basic Information

Symbol
E2F2
RNA class
mRNA
Alias
E2F Transcription Factor 2 E2F-2 Transcription Factor E2F2
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_004091.4
Sequence length
5196.0 nt
GC content
0.5743

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2096.30 kcal/mol
Thermodynamic ensemble
Free energy: -2186.16 kcal/mol
Frequency: 0.0000
Diversity: 1313.35
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((...(.((((((.((((.(((((..((((((((((.....))).(((((((((((((.(((..(.((.(((((.....(((((((..(((((((((((((((.(((((((((((.(((...((((((...))).))).))).))))))))...))).(((((((((..((...)).))))))))).......))))))).)))))......(((((.((..((.((((.((....)).)))).))..))))))).))).))))))))))))))).)))))))))))((((((.(((((((((((((.((((....((((((((...((((.(((((......)))))(((........)))((((((..(((..((.((((((((((((((((((.((..((((....))))..)).))))))..((.((......)).))(((((((((((.(((....(((.(((((((((.........((((.((.(.....).)).))))...((((.((((....)))).))))(((.....))))))))))))..((((....(((...........)))...))))..((((((.(.....).))))))((((....))))....))).....))).)).)))).))))).....))).))))))))).))....)))))))))))))....))))))))....))))((((...((((((((.(((....((((((......((((...))))....)).))))....)))))))))))...)))).....((((.........))))....((((((.(((((.(((((..(((.........))).)))))))))..........).)))))).(((((((((((.((((((((.(..((.((((((...((((.....))))...)))))).))...................((((((.....)))))).((..(((((((..((((.(((((((.(((((.((((((((((((((((((((((............((((((((.((((...(((((.((((((((((.(((((((((((.(..((.(((((((.(.(((((........))))).)))))))).))..).)).)))..((((((((((.(..((((.....((((((((((...(((((((((((((..(((...((((((.((..((...))..)).)))))))))..))(((((((((.....((((...((.(((((((.(((.((((((...((((.(((.(((((((....(((((((((((.....((((.((............)).)))).(((((((((((((.((((((...)))((((..(((......((((((.(((((((((((..(((((((((((((...(((........)))((((((((.......((((...(((((.....)).)))...))))..((....)).........(((((((((..((..(((((((.............)))))))...))...)))))))))((((((.(((........))).)))).)).((((.....))))((((....((((((((.((((.......(((.(((((((.((.(((....)))..((((.......)))).(((((((((.(((((((.(((((.....((((....((((((((((......)))))....)))))...))))....)))))))))))).))))......)))))..................)).)))))))))).....)))).))).))))).....))))....))))))))..))))))).))))))((((((((((..((..(((((..((((....))))..)))))..........))...)))))))))).......))))))).......(((((....))))).(((((((....)))))))..(((((((((..................))))))))).)))))))).)).....)))..)))).)))))))).))))))))(((((((..........))))))).......(.(((((.(((((((((.............))))...))))).))))).)((((((((........)))))))).)))))).........)))))..)))))))...(((((((..(((((......((((((..(((((((((((((....).))))))))))))....))))))...((((((....))))))(((((((((.(((((....((.((((..((......))..)))).)).....))))).)))))))))....)))))..)))))))...)))))))....))))))...)))))......)))))))...)))).))))))))).((((((((((((((((((..((.(((((((((((((((((((((.((((((((........(((((((((....)))))))))))))))))))).(((.((((....))))..))).((((.((((.....)))).))))..)))))..((((((((...(((((.((.........)).)))))..((((((((........(((.((((((...............((((((((((.((.(.(((((.((.((......)).))..))))).))))))))))))).((((..((....))..)))).................))))))..))).......)))))))).(((..((....))..)))))))))))))))))))..(((....)))))))).))..(((.((((.(((.((......))..))))))))))(((....))).........))))))))))))))))))..))))))...).)))).((((.....(((((((...((((((((..((((((((.((.......((((((...(((......(((..((((((((((((((....))).)))))(((((((((((((((((.(((((......(((....)))....)))))..((((((..((.(((((((..(((((((((((((((..(((.(((......(((..(((((((..(((((((...((((((......(((((..(((((((((........))))))))))))))....)))))).)))))))..)))))))((((.((((((....)))))).)))).(((..((..(((((((..((((((......))))))..)))))))..))..))))))......))).)))..))))))))).......(((.(((.(.(((((((((.((.......((..((((((((((..(((((......((((((...(((.(((.((........)).))))))......)))))).....(((((((((.......(((((((.((((........))))...))))))).......)))))))))...........(((....))).(((((........)))))...))))).)))))))))).))..))))))))))).).))))))....))))))..)))).....((((...((((((...((((..((((((((.....(((..(((((.....)))))..))).((((((((....)))))))).......((((.....))))))).)))))....))))...))))))...))))...))).))..)))))).))))))))...(((.(((((((((...(........).....))))))))).)))..(((((((((((..((.....))..))))))..)))))))))))))).))))))..))).....)))...)))))))).)))).)))))))))))).....)))))))..)))))))))).))))...))))..)))))))..)))).(((((((....((....))....)))))))..(((...(((((((((((............))).)))))))).))).....(((.((......)).))).....))))))...............(((((...))))))))))..))))).)))))...((((((((((.......))).)))))))....)))).)))))))))))))).))))))))))))((((((((((.....))))(((((...(((((((..(((.(((.(((((((..........))))))).).)).)))..)).))))))))))))))))(((..((((((((((((((((((...(((((.((((..((((((............(((.((((((..((((((((((...))))).)))))..........((((((.((((((..(((..((...((.((((.(........).)))).))...))...)))..)))))).)).....))))......((((((.(..(((.................((((....)))).......((((((((((.(((((((((.(((((.....)))))........))))))))).))))((((((((.((((((((.(((((......))))).))))).........))).))))))))...))).)))...)))..).)))))))))))))))))))))..))))..)))))....))))))......))..))))))..)))).)))........(((((((.(((..((((.(((((.((...)).)).))).)))).))).))))..)))(((((((((....)))))))))....(((((......)))))...........)))).))))))))))))(((((...))))))))))))))))..)).....).)))).)))).)))))))))))....((((.((.(((((.(((..((.(((((......)))))((((....))))))..)))..))))).)).)))))))))))...........))))))))))))..........(((((((((......))))).)))).))))))))))))..))).)).))))...)))))).)))))))....(((..((((((((((..((((......))))..)))).))..)))).....))).
Thermodynamic Ensemble Prediction
....((((((...,.((((((.((((.((((({.((((((((({.....})),(((((((((((((.(((..(.((.(((((.....(((((((..(((((((((((((((.(((((((((((.(((...((((((...))).))).))).)))))))}...)))}(((((((((,.,,...))}))))))))).......))))))).)))))......((((|{((.,((.((((.((....)).)))).))..))))))).))).)))))))))))))),.)))))))))))((((({,(((((((((((((.((((....((((((((...((((.(((((,...,,)))))(((,.......||}((((({.{(((..{(,((((((((((((((((((.((..((((....))))..)).))))))..{{.((......)).})(((((((((((.{((,...{||,((((((((((.......,((((.((.(,...,}.)).))))...((((.((((....)))).)))),{{.....)}))))))))))..{{({....{,,..,.....|,,||}...))))..((((((.,.....}.))))))((((....)))).}.,))).....}}}.)).)))).))))).....))).))))))))).))....)))))))))))))....))))))))....))))((((.,,(((((((({(((..,.(((({{.,....((((...))))..,.)}.)))).,..))))))))))).,,)))).....((((.........))))....((((((,(((((.(((((..((({.....,}.))}.)))))))))..,,,.....,.)))))).(((((((((((.((((((((.{..((.((((((...((((.....}}))...)))))).))......,{{.{{{{...{,((((({.{{{,||||||.{,..{{{{({({{({{,,(((({{(,(((((,{(((((((((((((((((((((............((((((((.((((...((({{,(((((({((({,,,{,||||{.,,..{{((({((((((((((((.((((((,{.{{||||||{{||.||{{({...|||,((((..((((.(((((((((.(.....}.)))))).)))..)))).)))}...,,.,}|||{{{}||..{{,,,,)}}))}}}}}|}},..{{{,,|,.||||,{|(((((((((((((({.,,{,,,(((((((((((((((((((...(((((((...(((({{.((((....((((.,,.....}}}}...,)}))}},(((((((((((((.((((((...}))((((..(((,{,...((((({.{{{((((((({{.(((((((((((((..,(((........)))|{||{{{{.......{{{{...(((((.....}}.|||,,,|||},,((,,,,|,||,,,...,(((((((((..,,..(((((((.....,.......)))))))...||...))))))))),{((((.(({........})).)))}|}}|}}}}.,,}}},)|||{{..,.((((((((.((((,,,....|||.||||,,|.,,.(({....}))..{(((.......}}}).(((((((((.(((((((.(((((,,,,,((((.,..(((((((({.,,....,))))}...)))))...})))....)))))))))))).)))|{({{{{{,,...,,..........,,...).})))))).}))}}}}.)))).))).)))))...,,))}),,,.)))))))}..))))))).))))))((((((((({,{((,.(((((..((((....))))..))))),,........))...))))))))}),}},..}))))})).{{{{,,(((((....))))}.(((((((....)))))))..(((((((((......,{,....,,,..))))))))).}))))))).))}....)))..)))}.)))))))).))))))))|((((((..........))))))}.((((.{((..(((.....)))})).)))).....,,.,,))))).))))))))))))||(((((........)))))}|(((({{(((((......((((.((((((.(((.{((((((...((((((........))))))...))))))}(((((((.(.{((....))}.).)))))))..{((((((....))))))}((((..(((((((((((((,({.((.(((((((,({{.....||,.....||,....}))))))))).)))))))}.((((((((((..(((....((((((.....((((((...(((((((..{.((((((.(((((((((((((((,((.(((((...))))).}))..))))))))))).....)))).)))))).....(((((((((....)))))))))..(((({|{(((((((.(((((((((((.((((((((((..(((((((.{,,.({{{..(((((..,(,(((((...,((((((,({{{..{{{{{{{,.{|{{((((((((..{...,.(((.((((((.......,.....,.((((((((({,((.(.(((((.((.((......)).))..))))).))))))))))))).((((..((....))..)))).................))))))..))),,..,..))))))))}}}}}..,.}}},,.....,,)))),)}}}.}})))),,.,}}})}}))))).})))}.))))))).))}.....))))))).....)))))){{.(((({.((.(((((.,.{(....})..}))))))).)))))}}{(,{((((((((......(((.....))))))))))))))))))).))))))).,))))).,{{((((({,..{,,,..{({({((((((((....))).))))){{{|||||||((,({.{{((,,,.)))}.)))}}}})))}}}..))))),}))))}),........,,,.{{{..((((((((((..((......,((,((((({...}))).)).))).)).))))))))))...,))).,}).}..)))))))))))))))))))..)))..))).)))))))......,)))))))))..))))....))))))))))))))))))))))),,.(((((((..((((((......))))))..)))))))...,...}})))))))))))..{{,{(((((((((.((((({{,(((((({..,.{(((((,,(((,.{{{{{{{((((((((((((..,{((.,..,,({...,.((((({(,...}),))))).),,,.),}},..,,,,)))))))),,(((((((((.......(((((((.((((.,....,.))))...))))))).......)))))))))..,.})))}..{{{,,,,))),|||||}},,..||||,},.,.,,....}}))||,.}))))),,,,))),...))),})))).)))))))).}|||.,.,})}.)))))))))))).,,),)))))),}}))))))}}.|||.,(({{{.....})))}..||}.((((((((....))))))))...|,||{{,{{{{{({|||{{{{((,,..,||,}},,)},...,.||||||{,||||||{{(((((((,{{(((.,,,...{|{.(((((((((...({,.....,)}....))))))))).}))|,{|||||,,,.,..,,))),((.((((({{(({((...{||||....})},,,}}},..,,)))))).)))))).)).,}}},,,}|},,,.......,|}}||,{||,|,,((((({{(,{{{,,.}}))},,))))}.,..(((.((((((((....((....))....))))))},).)))..(((((((((((............))).)))))))).|,{.....||}}}|......}...,,......,,,||}},,,,,,,,,....)))},))))))},))))),}))))),)))})|.{((((((((((.......))).)))))))..,,)))).)))))))))))))),}))))))))))){(((((((((.....))))((((,..,(((((((..(((.(((,(((((((..........))))))).).)).)))..))||)))))))))|))))|(((..{,,,.|,,|}||((((((,,.(((((.((((..((((((............{{{.(((((({.(((....)))(((((({(((((({.{(({.{((((((..,.((((((..(((..{(..,((.{(((.(........).)))),))..,}}...)))..)))))).(({....}))..((.......}}.,...)))))))})})))))))}.((((....))))..{{{...,}})}((((.(((((((((.(((({.....})))}........))))))))).))))((((((((.((((((((.(((((......))))).))))).........))).))))))))..(((|,|....)))))..))))))}))))))))}))))))..))))..))))),,..))))))...,}}})}}.,})))}))))),)})}}},}},.(((({((,{({..((((.(((((.({...}).)).))).)))).})}.))),.,))).,|||||||,,,,))))}}}))}}.}}||||}....,}))},,,.,||,....}))),)}}}})}}}}}}({((,,,|}}}})))}))))}}})}..,..,,.}.))))})})).)))))))))))....((((.((.(((((.(((..((,(((((......)))))|(((....)))}))..)))..))))).)).)))))))))))}..........})))))))))))..........(((((((((......))))).)))).))))),))))))}.)))},).))))}..)))))).,))))))....(({..(((({,((((..((((......))))..)))).},..}))}.....}}}.

Transcripts

ID Sequence Length GC content
AGAGAAAGACUCAAGGACUAGAGAGCGAGCCGCAAGGAAGUCGGUGCAG… 5196 nt 0.5743
Summary

The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F1 and E2F3, have an additional cyclin binding domain. This protein binds specifically to retinoblastoma protein pRB in a cell-cycle dependent manner, and it exhibits overall 46% amino acid identity to E2F1. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the E2F2 as a potential pathogenic biomarker for sepsis, with its expression significantly increased in the peripheral blood mononuclear cells of sepsis patients compared to healthy controls via RT-qPCR validation [Shi et al. DOI:10.3389/fimmu.2025.1640425]. Another human study analyzing severe burn injury recovery identified the E2F2 as a top biomarker with a sustained decreasing expression profile from the healthy state through the late recovery phase [Xu et al. DOI:10.1159/000493451].