Basic Information

Symbol
E2F4
RNA class
mRNA
Alias
E2F Transcription Factor 4 E2F-4 E2F Transcription Factor 4, P107/P130-Binding Transcription Factor E2F4 P107/P130-Binding Protein
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_001950.4
Sequence length
2110.0 nt
GC content
0.5810

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-840.80 kcal/mol
Thermodynamic ensemble
Free energy: -877.10 kcal/mol
Frequency: 0.0000
Diversity: 654.62
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((....(((((((.((((((((((((((((((((((.(((((.(((..(.....)..))).)))))((....))..))))))))))...))))))))))))....(((.......)))((((((((..((((........)))).........)))))))).))))))).((.((((((((..((((.((..(((((...((((((((..........((((((..(((((((..(((((......((((((...)))))).((((..((.(((((((...........)))))..))...)).))))((((((((((.((((((......)).....(((((.((((((((....((((((((((((((.(((((((...((((((..(((((((.(((((((.((((...(((.((((...)))).))).((((((((((((((((..(((.((((((((((((.((((....)))).))..))))).))).))..))).))))..)))))))))))).....(((((((.((......((((.((.((((((....)))))).)).))))...)))))))))(((((((((..........((((..(((((((....)).))))))))))))))))))))))))))((((.....(.((((((..(((.(((.....)))))))))))).)..))))..(((.((.....)).)))..)))..)))))))..))...))))...))))))).....(((.(((.((.((((((((((..(((((((...((....(..((((((((....(((..(((((((((((.(.(.....).))))))).))))))))....).)))))))..)....)).)))).)))))))))))))...)).))).)))...)))))))))).........(((((.(((.......)))...)))))...((((.(.((.((((.((((((.....))))))..)))).))).))))..((.((....)).))..)))).....)))))).)).))))).))))))))))))))((.((((((.....)))))).))(((.....)))..(((((......)))))(((((((((((....))))))....(((....)))....)))))((((..((((((((((((((((....((((.(........).))))...))))..(((((.......))))).(((..((...((((.....)))).))..))).(((((((((((.................((((((((.(((((....((((((.....))))))..((.(.((((.......)))).)))(((((((((..(((((.....)))))..)))))))))))))).))))))))))))))))))))))))))))))))))).....)))).)..))))))).))))))(((((((.((((..(((((....))))))))))))).)))(((((((((.(.((((((......((((.(....((((...(((((((...(((((........((((((....))).)))((((((...)))))))))))..)))))))...))))....))))).)))))).).)))))))))))))))))...)).)))..))...))))...(((((((....))))))).(((((((((((..((((.......))))..))))...((((.......))))...))))))).((((((.(((((((((((((.((((((((((.(((....(((((..((((.....)))))))))...))).)))).)))))).....((.....))..((((....)))))))))))).))))).))).))).)))......))))))).(((..((((((..........(((((.((..(.((((((.................)))))))..)).))))).......................((((....))))(((((((...))))))).......))))))..)))..((((((.......)))))))))).................(((...)))..
Thermodynamic Ensemble Prediction
.,({{.((((((((((((((.((((((((((((((((,(({((,.((((({((((((({{{|{({|((({((,.,,({{{||||||||}}...||||}}||||}}||,.(((.{{{{..||,((((((({..,.||.{(({,..,}}}.,,......))))))))||||||||.|||||||{{||,|||||}|||||.,,,,..||{{(((((((......}}||||}.{(((.,,,..||||{......{(((({...}}})}}{{||{..,..{{(({,,..}}}}.....,,))),,,..||||.{{{,((((((((((.((((((.,,,..}}.....(((((.((((((((....{{((((((((((({.(((((((.,.(((({(..(((((((,,((((((({..({,.(((.{{{{..,))}),)}|.((((((((((((((((..(((.((((((((((((.((((....)))).))..))))).))).))..))).))))..)))))))))))).,...(((((({.((......((((.((.((((((....)))))).)).))))..,)})))))))(((((((((..........((({..(((((((....)).))))))))))))))))))}||||,,}((({.....(.{(((((,,{((.(((.....)}))}))})))),),,),})},|,|.||..}}))))),}..,,,..)))))))..)}...)))).,.)))))))....{(((.(((.((.((((((((((..(((((((.{{,.....(,.(((((((,....(((..(((((((((((.,.{.....,,}))))))},)))))))....).))))))),,,....,)})))).)))))))))))))...)).))).))).}.}))))))))),....,,,,|{{{{,{|{.......)))...))))),,.((((.(,{{.((((.((((((.....))))))..))}),})}.))}),.||.||.}}.)).))..}})}.....))))))||}.})))).)))}))))))))))({.((((((,,...}}}})).}}{{{...,,|}|.|(((((......)))))||{||||{{{{...,))))},....({{....)))..,||))))||||.,|{||{((((||||,,|}}},||||,|}}},,}},},})))},{|||,..(((((......,))))).,||}},....{{{,.....}))}.||{{||,.(((((((((((.,.,,...,,.},....((((((((.(((((....((((((.....))))))..((,(,({,{.,,,...}})}.,}}(((((((((..(((((.....)))))..)))))))))))))).))))))))))))))))))).)))))))))))))))})))},,||{{{{,,|||||,|||||,,,,|{,.,||||},||{{{..,,))))}|||||||,{||((((((({(({..(({{((,{....}|)).},...}}},}}}},))}|})}}})))|))}}}...))))).}))))).}))){(((((...)))))}|||||..|{(||((.{.{|||.{{({|....)))))}}))),)}}))))))},,.,,...,|{|||{.|,{{{{|||.{{{(((((({...,,,))))}||||,,|||||}}|,||}}}}..))).)}.)))))))|,||}}}},,,||||..,,|||||,.,,((((.{(((((((((((({({(((((,,({(,({{{{((((({.(({{,,...}}},.)),,,,.)))}),))}))),))},...{{..,..}}..,|||}}..},}|}))))))).))))).)))},||,,.,...}.,}))}.,,.{{(.,((((((.,,.......{((((.((..{.((((((.................))))))}..)).))))}..,,,..,|||||........,,|}||..,.,,.{(((((({...}))))))},,,,,,))))))..)))..{(((((.......)))))}||||..,,)}}}.....}}..{|{...)))..

Transcripts

ID Sequence Length GC content
AGGAACGGAAGCGGAAGUGGCGGCGGCGCCGGCCUGGCCUGGCCUGGCU… 2110 nt 0.5810
Summary

The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the E2F4 transcript, a transcription factor involved in cell maturation and cancer, increased in relative abundance within 0.5 hours postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267].