| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCCUGAGAGCAGAGCUGGCCGCAGCCAUGACCCCGCAGCUUCUCCUG… | 1158 nt | 0.5959 |
This gene was identified by its induced expression in B lymphocytes in response Epstein-Barr virus infection. It encodes a secreted glycoprotein belonging to the hematopoietin receptor family, and heterodimerizes with a 28 kDa protein to form interleukin 27 (IL-27). IL-27 regulates T cell and inflammatory responses, in part by activating the Jak/STAT pathway of CD4+ T cells. [provided by RefSeq, Sep 2008]
A single-cell transcriptomic analysis in a rat model of radiation-induced lung injury identified the EBI3 as an overlapping gene among neutrophil upregulated genes, inflammatory response genes, and cytokine genes, associating it with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357].