Basic Information

Symbol
AGPS
RNA class
mRNA
Alias
Alkylglycerone Phosphate Synthase Alkyldihydroxyacetonephosphate Synthase, Peroxisomal ALDHPSY ADHAPS ADAP-S ADAS ADPS Aging-Associated Gene 5 Protein Alkyl-DHAP Synthase EC 2.5.1.26 Alkylglycerone-Phosphate Synthase Aging-Associated Protein 5 RCDP3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003659.4
Sequence length
7633.0 nt
GC content
0.3642

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2003.80 kcal/mol
Thermodynamic ensemble
Free energy: -2152.17 kcal/mol
Frequency: 0.0000
Diversity: 1799.60
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((.((.(((....))).))))(((((((((..((((.((((.(((((.((((((((((((..((((((.(....).)).)).((((.(((((.((((...)))).))))).))))(((.(((((((((((.(((....)))))))).)))))).))).((((((((..((((((............((((...))))..))))))...)))).))))...)).))))))).))))).)))))))))))))..)))(((......))).((((.((((((....((((((((((.((..((.((((((....((((........))))((((.....)))).((.((((((((((..((((((((.(((((((............))))..))).((((.(((((((((((((...(((.((((((.(((......(((((.................)).)))..........((((..(((((((((.((((((....((...(((((((((((.(((..........((((((((((........((((..(((((((((((.......))))..)))))))..))))))))))))))((((((((((.(.....).)))))))))).(((((.(((.((.(((((((......)))))))...((((((((.((((...)))))))).)))).........(((((.((.((((....))))..)).)))))...(((((.((...(((.((((((...((((((...........))))))....)))))).))))).)))))((((((((((.........))))...))))))(((((........)))))))))).)))))...((((((......))))))...(((..(((((..((.......))..)))))..)))((((.(((.....))).))))..((((.((........)).))))))))))))))))))...))....))))))..)))))...))))..))))........(((...)))((((((((.(((((((...((.((.((((.((((((((.(((.....((((((..........((((..(((((..(((((((....((((((((((((((((((((((((........((((........))))...(((......)))....))))))))......(((((((((.((.....)))))))))))((((((((.......((((((......)))))).....((....)).......)))))))).....(((((.((.....((((((.....(((..(((((((........(((((.((((((...(((.(((........))).)))....))))))..))))).(((((..((.(((((.(((((...((((((.((.((((((.....(((.((((...)))).))).....)))))).)).)).))))...)))))))))))))))))..)))))))..)))....))))))....)))))))..))))))))))).....))))).....)))))))...))))).....))))........((((..(((((((((((...))))).))))))))))((((((((...................(((((..(((((..(((.....)))..))))))))))))))))))..))))))......))).)))))....))).)))))).))..))))))).))))))))))).)))))).))).((..(((((((((...(((((((......(.((((((((((.(((..(((((.(((((.((((((((((..((((((.....((((((((((((((((((((((((..(((((((((.(((.((((((((.............))))))))(((((((((((((((.....(((...)))......))))))...)))))...))))......))).))))..)))))..((((((((....))))))))....((((...)))).(((((((....)))))))........(((((((.((((((((((.((..........))))))))))))))))))).....))))))))))))).......)))).)))))))..))))))..............)))))).)))))))))......)))))...))))))))))))).))))))))....)))))(((((.....)))))..........(((((((((.((.....((......))...)).)))))))))))))..)).....(((((..(((((((..((((((((((......(((((...)))))(((((((((...(((((((((.((((((((((.((((((.((((((((.....(((((((.(((((.........((..(((((((........((((((((.((((((((..((((((((.(((((.((((.(((((((((((((((((.((....)))))))((.((...((((..(((....)))..))))..)).))........((((((.......))))))...(((((((..((((((((...((((((((...(((..((((((((.((((((((.((.((((.....(((((.(((((((((.....))))).......)))).)))))....(((((......))))).......(((((((...))))))).)))).))))))))))..((((((....))))))((((((....)))).)).((((((((((((.......)).)))))).))))))))))))..)))...))))))))((((....)))).......))))))))....)).)))))((((((......))))))(((((.....((((.((((...........)))).))))...)))))((((((((....))))))))................(((((..((((((......((((((.((((.......)))).)))))).....))))))))))).)))))))))))).))))...))))).))))))))...((((((((....))))).))).....((((....)))))))))))).)))))))).(((((....))))).)))))))..)))))))..)))))))((((((((((((((((((((((.....))))))))).....)))))....)))))..))).)))).)))).)).)))).))))))))))..............((((((.......))))))...))))))))))))).)))))........(((((((((((((((...)))))....)))))))))).((.(((....))).))........)))))))))))))))))......))))).((((.(((((((((......)))(((((.(((((((((..(((((........((.((((.(((.((((((((..(((((.........(((((.......))))).....(((..(((((((.((........)))))))))..)))...))))))))))))).))).))))))........))))).))))...))))).))))).......((((((((.((......((((....)))).....)).)).))))))((((...(((((((((((((((..((((((((((.........))))))..........))))..).))))))))))))))...))))..............))))))))))(((..((((...(((((((((((((((((((((((((((((((((((........)))))))))))))))))))))))))))))))))))))))..)))............................)))))))).))))).))))((.(((....))).))))))))))..))))))))))..)).......(((...((((..((((.(((((....(((.......)))))))).)))).))))))).........((((((((....))...))))))......(((((.((....(((.....))).....))))))))))))).)))).))))))))))..)).)))).))))...(((((((....)))))))..........((((((((((.....)))........))))))).((((((((...))))))))..))))))......(((((((...((((((((((((.....(((((((((((..(((....))).)))))))((((((((..(((((..(((((((((((.(((((((....(((((((......((((..........)))).((((((.....))))))..((((((.((((((((.....(((((.(((((.((((((((..(((((((((............((((((((((((..(((((..(((((..(((((((((..(((((..........)))))..)))).......(((((.......))))).((((((..(((((((.....((((((((((((..(((.........(((((((((...((((((....(((((((((..((((((((.(((((((..((((((((((((..(((((((........)).))))).....((((..((((((..........))))))((((((((((((((((((....))))))....(((..(((((...)))))..))).(((((............))))).....((((((..........)))))).((((((..........))))))...((((((.(((...)))))))))........)))))))))))).(((((((((...(((((((...(((.(((((....((((((....))))))..))))).)))....((..(((((..(((((.(((....))).))))))))))..))..(((((...)))))...))))))).......(((((....))))).)))))))))((((((....))))))....))))(((((((.((((((((........)))............(((((((.......)))))))...(((((...)))))..(((((((((((((((((((((...((((.(((.((((((((.(((((((....))))..))))))))))).))))))))))))))..((((((((((.(((((.((((((....(((..((((((((.((...))...((((((((((......))))).)))))............((((......))))(((((....))))).........((((((.((((((..(((...((((((.(((.((.(((....))).)).))).))))))))).)))))).)))))))))))))))))...))))))..)))))................((((((...))))))((((.((........))))))((((.(((........))))))))))))).))))..........................(((((((....))))))).((..((((......(((((....((((((((((((......(((((..(((((......)))))..........)))))......))))...)))))))).....)))))......))))..))))))))))))........((((((...((.((((......)))))).))))))...................)))).))))))))))))..)))))))...)))))..)))))))))))))))...............)))))))))..))))))....))))))))))))..)))))))))))).........((((((((.........)))))))).(((((..((((......)))).....))))).)))))))..))))))..((((((((((((....(((((((........)))))))((((((((((..............(((((((....((((...(((..(((((.........)))))..))).....)))).....)))))))....(((...)))....((((.((((((....)))))))))).............((((((.(........)))))))....)))))....)))))....((((((((((...((((((((((..........))))))))))....((((...)))))))))))))))))))).)))))).....(((((((....))))))).....))))).....)))))..)))))((((((((((.((((((((((((((....((((((..((((.((.(((.((.(((((......))))).)).)))((((.....))))...((((((.....))))))...)).))))....))))))..))))))))))..)))).)))))...))))).......((((.....))))...)))).)))))))).(((((((((((........))))))))))).......(((((..((.......))....))))).............))))))........)))..)))))))).((((((((..((((((..(((.(..(.....)..).))).))))))..)))))))))))))..)))))((((...((.((((((..(((....)))..)))))))))))))))))))).))))))...........((((.......))))...)))))))(((.(((.(((.((...(((((((((((.........)))))).))))).(((((((((((((....(((..(((((((((.((((.(((.....))).)))).)))..))))))..)))...((((..........))))...(((((.....)))))(((((((.((((...))))..))))))).(((.(((((..(((((.(..((((((....(((((.........((((((((......(((((((..(((.....)))..)).)))))...........(((((((.((((((..(((((...........))))).....)))))).))))))).........((((.............)))))))))))).........))))).....))))))..).))))))))))))).....(((((((((....((((((((((..(((....))))))))(((((((.(((.(.((((.((((.((.(((((((....)))..)))))).)))).)))).)))))))...))))....)))))....)))))))))..))))))))))))).((((..((((...(((.((.((((.(((......))).)))).)).))).))))....)))).......)).))))))...))))))))))..)))))))))))))))))))).)))).(((((....)))))...(((((.....)))))...))))))))))).....))).)).)))))))........................
Thermodynamic Ensemble Prediction
.((.({.(((....))).}||}(((((((((..((((.((((((((((.((((((((((((,{(({(({.{..,,}}))})).((((.(((((.((((...)))).))))).))))(((.(((((((((((.(((....)))))))).)))))).))).((((((((,.((((((.....,......((((...))))..)))))).}.)))).))))..,,}.))))))).))))).)))))))))))))..)))(((......))).,(((.((((((....((((((((((.((..((.((((((....((((........)))}((((.....)))).((.((((((((((..((((((((.(((((((.{,....}}...)))}..))).((((.(((((((((((((.......{((((({(((,,,,{{(((({.........,||||...},.,,}..........((((..(((((((((.((((((....((...(((((((((((.(((..........{(((((((((........((((({(((((((((((.......))))..)))))))))))),)))))))))}((((((((((.(.....).)))))))))).(((((.(((.{{.(((((((......)))))))...{((((((,{((((...})))))))},))}.........{{{||,((.((((....)))),,||,||}},.|}|{(({.{(.,.(((.((((((...((((((...........)))))),...)))))).)))}}.}}}}}{{({{(({((,.,.....,)))),..}))))}((((({.....}})))))}}))).)))))...((((((......))))))...(((..(((((..((.......))..)))))..)))((((.(((.....))).))))..((((.((........)).)))))))))))))))))).,.))....))))))..)))))...))))..))))........(({...)))((((((((.(((((((...((.{(.((((.((((((((.(((.....((((((.......{{.(({,..(((((..(((((((.,,.((((((((((((((((((((((((........((((........))))...(((......)))....))))))))......(((((((({,((.....)))))))))))((((((((.......((((((......))))))....,((....)).,.....)))))))).....(((((.((...,.((((((.....(((..(((((((........(((((.((((((...{((.(((........))).)))....))))))..))))},(((((..{{.(((((.(((((...(((({({{(,((((((.....(((.((({...}))).))).....)))))).}).)).))))...)))))))))}}))))))}.)))))))..)))....)))))),...)))))))..))))))))))}....,))))).,,..)))))))...))))).,,.}))}}..,,,...((((..(((((((((((...))))).)))))))))){{{||{{{,,,...............{(((((..(((((..(((.....)))..)))))))))))))))))),.))))))......))).))))}...,))).))))}}.))..))))))).)))))))),},.}}))}}.,||{{{{.||},}{(((({....{(({......(((((((((.((((((((....(((((.(....).)))))((((,((.(((....})))},})))).(((((((((.(((((.((({({{{{,,((((((.{((((..((.(((((((((((,..{((((((((...{{(((((((..,{((.{{{,...,||{(((((((...,,,,,.,,,{,{{({(((({,,(({{,((((((((....))))))))....{{{,...,}))}||||,,|}}}}))},,||,,,.{{..,,||||||||,,,||||,|{|,||||,,....))}}}}}}},},,)})))}))))...}}}}},})))},}}..))))))}.}))...)))))))))))))}})))))).,,}}..))))}.)))))).,,.}}}}....,.})).))))},...((((((.(((({..((((((.....)))))).....,((((((((((((.((....,{,......)}...)).))))))))},)))}........|{{,|},|{{({{,,(((((.(((((..(((.(((({...}))))..))}.))))))))))||||{.((((((((((.((((((.((((((((.....(((((((.(((((..,.,,...{{|,(((((({.,,,.|{,((((((({.((((((((,.((((((((.(((((.((((.(((((((((((((((((,({....),))))|((.((...((((..(((....)))..))))..)).)),.......((((((.......))))))...{((((((..((((((((.,(((((((((...(((..((((((((...(((((((((((...})))))))))).{{{{{(((.,{{{||||,.........,,.})))}}}}.||{{{,,....}||}},,.....(((((({...})))))).,}||,}},,}},||,..{(((({....)))))}{{((((....)))).)},((((((((((((.......)).)))))).))))))))))))..)))...))))))))|{{{....}}},.......))))))))....)),,)))}((((((......))))))(((((.,,,.((((.((((...........)))).))))..,)))))((((((((....))))))))................(((((..((((({...,{.((((((.((((.......)))).)))))).,...))))))))))).)))))))))))).))))...))))).))))))))..,((((((((....))))).))}.....{{{,....,))))))))))).})))))},.|||||.,..},}}}.))))))}..}})))))..))))))){{{((((((({{{{{{{(((((.....}}}))))}}.,,,.)},,}.,,.}))))..))}.)))).)))).)).)))).))))))))))..,,...,,,....,{{{{{.......}}}}}}}}}}.}))))},((((({{{{{..({{...,,,,,|||,((((((...))))))}}})))))))}||.,{,,,|.,,.((.(((((,...,))))))){||||||,,||...,.,|||||{(({...,,,.((((......))))...{{{{||,|,.,..,,}},,,.}}}}}}})}}}}),,,,}}},...,{{{{{.,....,,)))}}}))..}}}}}))......))))))))}..........{{{{{,|||||||,......,,.}},..}})))})))))))).)))))))))..}}}}.}))))},{{{{.,,.....}}}}}...{||{{{{{.,,,,,||||||}}.,,||||{.,,,||.||.}||||,((((...(((((((((((((((..(((({{{{{{.........}}}}}}..........))))..),})))))))))))))...)))).}},,........,}}}}))}}},|||,,|{{{,,{(((((((((((((((((((((((((((((((((((,......,))))))))))))))))))))))))))))))))))))})),.|||{{|,.....,,,,...))),,...,,..)))))))),,)))).))))((.(((....))).))))))))))..))))))))))..))....,,{{{{.,,((((,.((((.(((((..,,,{,....,,.},,))))).}})},}}|||,,........,{{|||{{,.,}})),..)))})),.....((({{{((....{{{.....))).,...))))))))))))).)))).))))))))))..)).)))).)))}...(((((((....)))))))..........(((((((,,,.....,,,........))))))}.((((((({...})))))))..)))))).,....(((((((...((((((((((((.....(((((((((((..(((....))).)))))))((((((((..(((((,.(((((((((((.(((((((....{{{{{((....,,{{,,...,,....,||,,.{(({{{.....|||||},{||||((,((({{(((,....{|||{.{{{||.{{{((({{.,{{{{.,,,.............{{((((((((((..{{(((..{{(((,.{((((,{((..(((((..........)))))..)))),......(((((.......))))).((((((..(((((((.,.,.((((((((((((..(((.........(((((((((...((((((....(((((((((,{((((((({{(((((((..(((((.((((((..(((((((,,......)).)))}}..,,,{{{{.,((((((,.........))))))((((((((((((((((((....))))))}{{,{((,,{((((...}}}}|..}}}.{||||.,,,...,,,,.)}}},.....((((((..........)))))).{(((((.||....,,,))))))...((((({,(({...}))))))))........,))))))))))).{((((((((,{.{((((((...(((.(((((....((((((....))))))..))))).)))..,.((..(((((..(((((.(((....))).})))})))))..))..(((({...,})))...}))))}|.,,,,..{((((....))))),})))))))}((((({....})))))....}}}}{((((((.((((((((........))}..........,,(((((((.......))))))),,.(((((...))))),,({{{((((((((((.(((((((.(((((((((({,,{|(|((,{{(((({..{({{..,||{.((((((|,,.|{,,......)).}},.)))))).))})))))))))),)}.}),))}}}},,)))})))))))}...))))))).{{(((((((,,,,|{{{{{{({.........(((((({((((({((((,{(({{{,.,,,,,,,..((((((.((((((..(((,..((((((.(((.,,.(((....))).}}.))).))))))))).)))))).)))))).|||,,..{{{{,.((,{{....}}.}}.}}}}}....,,,,.{{{{{{...))))))|,|||||,.,.},,.))))),((({{(((........)))))))..,}}}},{,,......}},}}},,,},,........(((((((....)))))))...{(((((.{(({(,.....}},|||,,,})))}}.,{{,,..}},..(((((......))))))))))).....}))))))},),,,....)))))))))....,,||,{{{{{...))))).))))))))))........((((((...((.((((......)))))).))))))......,...........,))}},))))))))))))....})))),,.)))))..))))))))))))}}}...........,}}})))))))))..))))))....))))))))))))..)))))))))))).........((((((((,{,....},)))))))),(((((..((((......)))).....))))).)))))))..)))))),,((((({{{{{||,,,.(((((((.{....,.)))))))((((((({{{...............,|||||,,.,((((,..{((..(((((,({{,.{{.}||}}..)),.,,}}))),,,,.,}|||||....,|||,}.,,},},,{(((.((((((....))))))}))).............{{{{{,.{...,,,,,||}|||},,,,|}}||..,,||||}....,{(((((({,...((((((((((.{{.....,.))))))))))....{{{,,,.,,||||||||||},}))))))))))}}.....{((((((....))))))}.....}}}}}..,.,}))}}.,||}},((((((((({.((((((((((((((.,..((((((..(({(,{,.{((,((.(((((......))))),)).}))((((.....)))),,,((((((.....))))))...,),)})),,..)))))).,))))))))))..)))).}))))...)))))...,{,,(((,.,,,,}}},...)))).})))))}}.(((((((((((........)))))))))))....,{{(({{{{,((.......)}.}).,})))},.............}}}...,.|||}},,..}))))))).((((((((..((((((..(((.(..{.....)..}.))).))))))..))))))))}}}}},,))))}||{|..,||.|||{{{.,(((,.,,|||,,}}}}}}}}))))}))))))).))}}||{,.....}}}}|||,.......,,,,...))}))))||{,||{,||||||||.(((((((((((.........)))))).))))).{((((((((((((...........(((((((,(((({((.{{({(|,....,).))),,),))))},})|,..{{{|,,........}}}}..{(((((.....)))))},{((((,((((,,,|}}}.,))))},..,}}}|||||}.(((((,{.,((((((.,..(((((.........((((((((..,...{{{(({(..(((.....})}.,|},,}|||......,,,..(((((((.(((((({{(((((,,......,.,)})))},...)))))).))))))).....,,..{{{{.||,.....,...))}})))))))).........)))))..,.}}})))).,},))))))}))}.)))))}}(((((((((....((((((((((..(((....)))}}))){((((((.(((.{.((((.((((.(,,(((((((....)))..)))))).)))).)))).,)))}}},,,)))}.,,,)))))....)))))))))..))))))))))))).|||||.||||.,.|||,||.((({.(((......))).}))).,}.}))...,}}}..,)))},,},..,,.}}}}})...}}}))))))),.)))))))))))))))))))).)))).{((({....))}))}|,{{|{{.....})))}...))))))))))).....))).}).)))))))........................

Transcripts

ID Sequence Length GC content
AGCACAAGGCGGUAGCCAUGGCGGAGGCGGCGGCUGCAGCGGGUGGGAC… 7633 nt 0.3642
Summary

This gene is a member of the FAD-binding oxidoreductase/transferase type 4 family. It encodes a protein that catalyzes the second step of ether lipid biosynthesis in which acyl-dihydroxyacetonephosphate (DHAP) is converted to alkyl-DHAP by the addition of a long chain alcohol and the removal of a long-chain acid anion. The protein is localized to the inner aspect of the peroxisomal membrane and requires FAD as a cofactor. Mutations in this gene have been associated with rhizomelic chondrodysplasia punctata, type 3 and Zellweger syndrome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in Wistar rats demonstrated that acute exposure to 60% CO₂ significantly increased the expression of the AGPS mRNA in the frontal cortex compared to control and lower concentration groups, as validated by qRT-PCR [Sato et al. DOI:10.1016/J.Legalmed.2015.07.014]. Subsequent research in mice, while not experimentally studying this marker, referenced it in discussion as a candidate adjunctive diagnostic marker for CO2 intoxication [Yatsushiro et al. DOI:10.1007/S12024-025-00981-1].