| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGUAGACGAAGGCGGCGGCGAUGGCGGCGGGGAUAGUGGCUUCUCGC… | 1200 nt | 0.5783 |
This gene encodes a member of the hydratase/isomerase superfamily. The gene product shows high sequence similarity to enoyl-coenzyme A (CoA) hydratases of several species, particularly within a conserved domain characteristic of these proteins. The encoded protein, which contains a C-terminal peroxisomal targeting sequence, localizes to the peroxisome. The rat ortholog, which localizes to the matrix of both the peroxisome and mitochondria, can isomerize 3-trans,5-cis-dienoyl-CoA to 2-trans,4-trans-dienoyl-CoA, indicating that it is a delta3,5-delta2,4-dienoyl-CoA isomerase. This enzyme functions in the auxiliary step of the fatty acid beta-oxidation pathway. Expression of the rat gene is induced by peroxisome proliferators. [provided by RefSeq, Jul 2008]
A study in Phormia regina maggots demonstrated that the ECH1 (dienoylcoenzyme A isomerase) is an RNA marker upregulated as maggots age from 80 to 130 hours at 27.5 °C, with its expression pattern identified through differential gene expression, weighted gene co-expression network analysis, and a generalized linear model to delineate larval age for postmortem interval estimation [Lin et al. DOI:10.1371/journal.pgen.1011948].