Basic Information

Symbol
ECH1
RNA class
mRNA
Alias
Enoyl-CoA Hydratase 1 HPXEL Delta(3,5)-Delta(2,4)-Dienoyl-CoA Isomerase, Mitochondrial Delta3,5-Delta2,4-Dienoyl-Coenzyme A Isomerase Enoyl Coenzyme A Hydratase 1, Peroxisomal Enoyl-CoA Hydratase 1, Peroxisomal Peroxisomal Enoyl-CoA Hydratase 1 Epididymis Secretory Sperm Binding Protein Delta3,5-Delta2,4-Dienoyl-CoA Isomerase Dienoyl-CoA Isomerase EC 5.3.3.-
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_001398.3
Sequence length
1200.0 nt
GC content
0.5783

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-451.50 kcal/mol
Thermodynamic ensemble
Free energy: -470.92 kcal/mol
Frequency: 0.0000
Diversity: 212.20
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((....((((..((((((((((((.(((((((((...(((((((((((((((((((((((...........((.(.((....))).))........((((((((....((((....(((.....)))((((((.....))))))(((((((.(((.....))).).))))))..........)))))))))))).))))).)).))))))((((((.....)))))).(((...(((.....)))...))).)))))..)))))....((((((((((((.(((.((((((.(((..(((....)))..)))(((..(((((((...((((((.(..((.(((((((((((((((...(((((((...(((((....))))).)))))))...........))))))).))....)))))).)).).)))))).)))))..))..)))......)))))).)))....))))))))))))..((.((.....)).)).))))..).)))).))))))))))))...(((((((((.((((.((((((((((....((((((.....))))))...(((.(((....(((.((((((..(((((((((....(.((((..(.((.(((((((((((((((((.....)))))((....))....((((..((((((..(.(((..(((..((......((((.(((((((((.........(((((((..(((((........))))).)))))))(((....))).........((((.(((((((.((((((........)))))).......))))))).)).)).)).))))))).)).))......))..))).))).).)))))).))))..))))))))).))).)).)..)))).)..)).)))))))...)))))).))))))))).....(((.((....((((((........))))))..)).))).........))).))))))).))))))......))))))).))))...((((((......))))))(((((((...((((.(((((.(......)..)))))))))((((.((((((...........(((...)))...........)))))))))).....((((...))))....))))))).........................))...........
Thermodynamic Ensemble Prediction
{{....((((..((((((((((((.(((((((((...(((((((((((((((((((((((..,,{{(,{{{((....,,...},...,......,,|||{{|||,,,.{{{{....(((.....)))((((((.....))))))(((((((.(((.....))).).))))))...,,,....}}}}))})))}}.))))).)).))))))((((((.....)))))).{{{...(((.....)))...}},.)}))}..)))))....((((((((((((,{{(,({((((.({({.{{{......,..,,|{,{.|{{(((((...((((((.{..((.(((((((((((((((...(((((((...(((((....))))).)))))))...........))))))).))....)))))).)).}.)))))).))))).|))..)))}}..,.}))))),)))..,.))))))))))))..,{.{(,,,..}}}))}))))..)})))).))))))))))))..{(((((((((.((((.((((((((((....((((((.....))))))...(((.(((,...(((.((((((..((((((({{....(.((((..(.((,(((((((((((({((((,....}}}}|{{.|||))....((((..((((((..{.(((..(((..{{....,,((((.((((((((({........(((((((.{(((((........))))).)))))))(((....))}.,,,.....{|||.(((((((.((((((........)))))).......))))))).)),)),))}))))))).)).)).....,))..))).))).}.)))))).))))..)))))))))})}},)).)..)))).)..}}.)))))))...)))))).))))))))),..,.(((.((....((((((........))))))..)).)))...,,....))).))))))).))))))......)))))))}))))...((((((......))))))(((((((...((((.(((((.{......}..))))))))),{{{.((((((......,....(((...)))......,,...))))))}}}}.....((((...))))....))))))).........................}}...........

Transcripts

ID Sequence Length GC content
GCAGUAGACGAAGGCGGCGGCGAUGGCGGCGGGGAUAGUGGCUUCUCGC… 1200 nt 0.5783
Summary

This gene encodes a member of the hydratase/isomerase superfamily. The gene product shows high sequence similarity to enoyl-coenzyme A (CoA) hydratases of several species, particularly within a conserved domain characteristic of these proteins. The encoded protein, which contains a C-terminal peroxisomal targeting sequence, localizes to the peroxisome. The rat ortholog, which localizes to the matrix of both the peroxisome and mitochondria, can isomerize 3-trans,5-cis-dienoyl-CoA to 2-trans,4-trans-dienoyl-CoA, indicating that it is a delta3,5-delta2,4-dienoyl-CoA isomerase. This enzyme functions in the auxiliary step of the fatty acid beta-oxidation pathway. Expression of the rat gene is induced by peroxisome proliferators. [provided by RefSeq, Jul 2008]

Forensic Context

A study in Phormia regina maggots demonstrated that the ECH1 (dienoylcoenzyme A isomerase) is an RNA marker upregulated as maggots age from 80 to 130 hours at 27.5 °C, with its expression pattern identified through differential gene expression, weighted gene co-expression network analysis, and a generalized linear model to delineate larval age for postmortem interval estimation [Lin et al. DOI:10.1371/journal.pgen.1011948].