Basic Information

Symbol
EEF1A1
RNA class
mRNA
Alias
Eukaryotic Translation Elongation Factor 1 Alpha 1 Elongation Factor 1-Alpha 1 EF1alpha1 EE1A1 EF1A1 EEF1A LENG7 EF1A Leukocyte Receptor Cluster (LRC) Member 7 Leukocyte Receptor Cluster Member 7 Eukaryotic Elongation Factor 1 A-1 Elongation Factor Tu EF-1-Alpha-1 EEF1A-1 EF-Tu Eukaryotic Translation Elongation Factor 1 Alpha 1-Like 14 Glucocorticoid Receptor AF-1 Specific Elongation Factor Translation Elongation Factor 1 Alpha 1-Like 14 Epididymis Secretory Sperm Binding Protein Elongation Factor 1 Alpha Subunit Prostate Tumor-Inducing Protein 1 Cervical Cancer Suppressor 3 CTCL Tumor Antigen EF1a-Like Protein EC 3.6.5.- GRAF-1EF CCS-3 EEF-1 CCS3 PTI1
Location (GRCh38)
Forensic tag(s)
Individual identification

MANE select

Transcript ID
NM_001402.6
Sequence length
3512.0 nt
GC content
0.4245

Transcripts

ID Sequence Length GC content
CUUUUUCGCAACGGGUUUGCCGCCAGAACACAGGUGUCGUGAAAACUAC… 3512 nt 0.4245
Summary

This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the EEF1A1 was identified as a housekeeping gene exhibiting differential expression between a female monozygotic twin pair, belonging to the least variable category of genes [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. This research found that housekeeping genes, including the EEF1A1, were nearly insensitive to random environmental variations between twins but appeared more susceptible to genetic differences between unrelated individuals.