| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUUUCGCAACGGGUUUGCCGCCAGAACACAGGUGUCGUGAAAACUAC… | 3512 nt | 0.4245 |
This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the EEF1A1 was identified as a housekeeping gene exhibiting differential expression between a female monozygotic twin pair, belonging to the least variable category of genes [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. This research found that housekeeping genes, including the EEF1A1, were nearly insensitive to random environmental variations between twins but appeared more susceptible to genetic differences between unrelated individuals.