Basic Information

Symbol
EEF1A2
RNA class
mRNA
Alias
Eukaryotic Translation Elongation Factor 1 Alpha 2 EEF1AL HS1 STN Eukaryotic Elongation Factor 1 A-2 Elongation Factor 1-Alpha 2 EF-1-Alpha-2 Statin-S1 STNL Statin-Like EC 3.6.5.- EEF1A-2 Statin EIEE33 DEE33 MRD38 EF1A
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_001958.5
Sequence length
1773.0 nt
GC content
0.6458

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-750.20 kcal/mol
Thermodynamic ensemble
Free energy: -775.97 kcal/mol
Frequency: 0.0000
Diversity: 380.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((.((.....((((.(((.....))).)))).........)).))))))))......((((((((((((((((((...((((((......))).......((.((((.((.........)))))).))((((.(((((.....(((...)))....)))))))))(((((..(.......)..)))))..........((((.........)))))))...)))).))))).).))))(((((...)))))..((..((((((((((.(((..((((...(((((.(((....)))((((((((((((((.((.(((....))).))))))..(((((..((.((((..((((....((((((((....(((((((.((..((((.......)))))).)))((((((((..(((((...((((((.(((..((((((.(((..(((((((.(.......((((((....((((.....((((...((((((.(((((((..(((.((......(((((((.((.(((.(.((.((((((((((..((.....((.(((....))))).......((((.....))))..((((....))))......))..)))))))).....)).)).).))).))))))))).....((((((((.((((((((((((((((.(((((......((((.(((.........))).))))))))).).....)))))).)))))).)))...))))))))..)).)))))))))).))))).)...))))))))......)))))))))))))))))))))))...)))..))))))...)))))...)))..))))).....))))))))))))...))))...))))))..)))))...(((((........)))))...)))))))).))...(((((.(((..((((.(((((((.......))))))).)))))))..((.(((...((((...)))).))))).(((((.(((...(((((...))))).)))))))).((((((((.((((((((((......((((((((.(.....(((.((((((((((.(((((.((.......)))))))((((.......))))......((((.((......)).))))((.(((((((((((((..((.((...((((((.((..((......)).)).)).))))..))))..)).)))))))..(((((((.....)))))))...........(((((........)).)))(((((((((((......(((((.((((((((((((....))))...)))).)))).))))).((((((((..(((......)))..)))...)))))..)))))))))))..((((........)))))))).))....))))))((((((((..((...))..))))))))....(((((....((((((...(((..(((.(((.(((((((((((..((......))..)))))))((.(((.....)))))..))))))))))..))).))))))....))))))))).)))))))))))))))))))(((.(((....))).))).((((.(((.(((...)))))).))))(((((((.((........)))))))))))).))))))))........)))))..)))))...))))))))))))))).))..))..((((((((.................))))))))))))..
Thermodynamic Ensemble Prediction
..((((((((.((.....((((.(((.....))).))))......,..)).))))))))......((((((((((((((((((...(((({{,,....}}}),..},.|,.(({{{((.........)))))).}}((((.(((((.....(({...)))....)))))))))(((((..{.......)..)))))..........,|||,.||,,...}}))}},...)))).))))).).))))(((((...)))))..((..((((((((((.(((..((((...(((((.((({,.{{{{(((((({(({({((,.{,{{(,,,,}|}.||}}}},|{,,{|..{,....{,{(.,,......||||(((((((((.,,{.,...{{((,,.....,)))}({{((((((.{((..(((((...((((((.(((,.((((((.(((,.(((((((,{.....|.((((((..,.((((.....((((...{(((((.((((((({{(((,{{...,..(((((((,({.(((.{.((.((((((((((..((....,((.(((....)))))}.,,,..((((.....))))..((((....))))..,,..))..)))))))).....)).)).,.))).)})))))))....{((((((((.((((((((((((((({.(((((,.....{(((.(((.{.......))).))))))))).}.....))))))},))))).))),..}))))))}.})).}),))))))).))))).}...))))))))......))))))})))))))))))))))).,.}))..))))))..,)))))...))}{{|||.|,,...,|,,,})})))))}}))))))))))))))))),))...(((((........))))),},}))))))}.}}.,,||||{.(((..((((.(((((((.......))))))).))))),},.{(.(((...((((...)))).))))).((((,,(((...(((({...})))).)))))))).((((((((.((((((((((......((((((((.(.....(((.((((((((((.(((((.{(.......}})))))((((.......))))......((((.((......)).)))){{.(((((((((((((..((.((...((((((.((..{{......)}.)).)).))))..))))..)),})))))).,(((((((.....)))))}|(,,........||||{.....,{,}|.|||(((((((((((......(((((.((((((((((((....))))...)))).)))).))))).((((({{{,{(((.....,},)}}))}...)))))..)))))))))),..||||}.,,..),,}}})))).})....))))))((((((((..((...))..))))))))....(((((....((((((...(((..(((.(((.(((((((((((..((......))..)))))))((.(((.....)))))..))))))))))..))).))))))....))))))))).)))))))))))))))))))(((.(({....))).))).((((.(((.(((...)))))).))))(((((((.{{........}))))))))))).)))))))}........,))))..)))))...))))))))))))))).))..))..((((((((.................))))))))))))..

Transcripts

ID Sequence Length GC content
CCCUCUGGCUGAGACCUCGGCUCCGGAAUCACUGCAGCCCCCCUCGCCC… 1773 nt 0.6458
Summary

This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 2) is expressed in brain, heart and skeletal muscle, and the other isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas. This gene may be critical in the development of ovarian cancer. [provided by RefSeq, Mar 2014]

Forensic Context

A study in mice demonstrated that the EEF1A2 was downregulated in cardiac mesenchymal stem cells following HDAC11 overexpression, as part of a broader transcriptional reprogramming that promoted cell cycle progression and proliferation [Zhang et al. DOI:10.3390/biom15050662]. In forensic science, the EEF1A2 is identified as a protein marker whose abundance decreases post-mortem in skeletal muscle, contributing to post-mortem interval (PMI) estimation [Alex et al. DOI:10.1016/j.scijus.2025.101320]. A study in mice demonstrated that the EEF1A2 exhibits a significant decrease in band intensity with increasing post-mortem interval, establishing its utility as a protein marker for PMI estimation [Lopez et al. DOI:10.1016/J.Forsciint.2025.112412].