| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCCUCUGGCUGAGACCUCGGCUCCGGAAUCACUGCAGCCCCCCUCGCCC… | 1773 nt | 0.6458 |
This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 2) is expressed in brain, heart and skeletal muscle, and the other isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas. This gene may be critical in the development of ovarian cancer. [provided by RefSeq, Mar 2014]
A study in mice demonstrated that the EEF1A2 was downregulated in cardiac mesenchymal stem cells following HDAC11 overexpression, as part of a broader transcriptional reprogramming that promoted cell cycle progression and proliferation [Zhang et al. DOI:10.3390/biom15050662]. In forensic science, the EEF1A2 is identified as a protein marker whose abundance decreases post-mortem in skeletal muscle, contributing to post-mortem interval (PMI) estimation [Alex et al. DOI:10.1016/j.scijus.2025.101320]. A study in mice demonstrated that the EEF1A2 exhibits a significant decrease in band intensity with increasing post-mortem interval, establishing its utility as a protein marker for PMI estimation [Lopez et al. DOI:10.1016/J.Forsciint.2025.112412].