| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCCAGAAUACAUUUCCAACAAGAGCACUGGCCAAGUCAGCUUCUUCUG… | 738 nt | 0.3631 |
This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This gene is expressed in ciliated airway epithelial cells and, in mouse, plays a role in ciliary beat frequency in multiciliated cells. This gene is also over-expressed in breast, ovarian, and prostrate cancers. [provided by RefSeq, Dec 2016]
The AGR3 is an evolutionary conserved PDI-like protein present in all vertebrates, and its expression, along with AGR2, is considered a prognostic marker for hormone-responsive breast tumors [Kosykh et al. DOI:10.3390/ijms24097895].