Basic Information

Symbol
AGR3
RNA class
mRNA
Alias
Anterior Gradient 3, Protein Disulphide Isomerase Family Member BCMP11 PDIA18 HAG-3 Protein Disulfide Isomerase Family A, Member 18 Breast Cancer Membrane Protein 11 HAG3 Anterior Gradient Protein 3 AG-3 AG3 Anterior Gradient 3 Homolog (Xenopus Laevis) Anterior Gradient Protein 3 Homolog Anterior Gradient Homolog 3 Anterior Gradient 3 Homolog
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_176813.5
Sequence length
738.0 nt
GC content
0.3631

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-165.90 kcal/mol
Thermodynamic ensemble
Free energy: -181.42 kcal/mol
Frequency: 0.0000
Diversity: 193.89
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((.............(((((((..((((..((((...((((((((((...)))).))))))..))))(((......)))....))))..)).)))))...........((((((......((((....))))......)))))).((((((((((((....(((....)))..)))))))......(((..((.((((((.((..(((((((((((((...((((.((............(((((((....((..(((.(((..(((......((.((((((.((..........)).)))))).)))))...))).)))..))....)))))))(((.((((((((.((((((..........))))))............))))))))...))).((((((.....))))))))..))))...).))).)))))))))...(((((((((..((....))..))...))))))))).)))))).))..))))))))(((......)))......((((((((((...........(((((((.((((((.(((((..........(((.((.......)).)))(((((..(((((...))))).))))).....)))))(((((((((.(((.((((((((((....((((.......))))....))).))))))).))))))))))))))).)))))))))).........))))))))))..)))).
Thermodynamic Ensemble Prediction
...((((......,,,,...,{(((({.,((({..((((...((((((((((,..}))).))))))..}}}}(({......))).,},})))..}|||||||..........,{(((({......((((....))))......}))))},|||||(((((((..,.(((....))),.)))))))......(((..((.(((({{.{{..{((((((((((({{{{{.((((......})}}.|,{((((((..,.((..(((.(((..(((.{....{{.((((((.((..........)).)))))),}))))...))).)))..))....)))))))}.{,,..,{{|,.((((((..........))))))......{(((((....)))))},,{{{{(((({.....|)))}|.,|||,,||..,.|)),,})))))}}.,,((((({({{..{,...,))..))...))))))))).)))))).))..))})))))(((......))}......{(((((((((...........(((((({,{{{({{.(((((,......,,.{((.((.......)).))}(((({..((({{...})))).))))).....)))))(((((((((.(((.((((((((((..,{((((......,))))....}}},))))))).))}))))))))),}).}}}))))))).........))))))))))..)))).

Transcripts

ID Sequence Length GC content
AUCCAGAAUACAUUUCCAACAAGAGCACUGGCCAAGUCAGCUUCUUCUG… 738 nt 0.3631
Summary

This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This gene is expressed in ciliated airway epithelial cells and, in mouse, plays a role in ciliary beat frequency in multiciliated cells. This gene is also over-expressed in breast, ovarian, and prostrate cancers. [provided by RefSeq, Dec 2016]

Forensic Context

The AGR3 is an evolutionary conserved PDI-like protein present in all vertebrates, and its expression, along with AGR2, is considered a prognostic marker for hormone-responsive breast tumors [Kosykh et al. DOI:10.3390/ijms24097895].