| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUCACCCCGUCCAGCUUCAUCCGCAGAGGAGCCUCGGCCAGGCUUGCC… | 2406 nt | 0.4680 | |
| GCUCACCCCGUCCAGCUUCAUCCGCAGAGGAGCCUCGGCCAGGCUUGCC… | 2403 nt | 0.4677 |
This gene encodes a member of the epidermal growth factor (EGF) repeat superfamily. Members of this superfamily are characterized by the presence of EGF-like repeats and are often involved in the regulation of cell cycle, proliferation, and developmental processes. The gene product contains a signal peptide, suggesting that it is secreted; an EGF repeat region consisting of 4 complete EGF-like repeats and 1 partial EGF-like repeat, 3 of which have a calcium-binding consensus sequence; an arg-gly-asp integrin association motif; and a MAM domain, which is believed to have an adhesive function. This gene is expressed early during development, and its expression has been detected in lung and meningioma tumors. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the EGFL6 was the most upregulated gene in subcutaneous adipose tissue of heavier monozygotic co-twins, with an 8.90-fold change, and was identified as part of a 38-gene obesity signature strongly correlated with body mass index and fat mass [Muniandy et al. DOI:10.1038/ijo.2017.95; Francesc Font-Clos et al. DOI:10.1088/1361-6579/aab85a].