Basic Information

Symbol
EHMT2
RNA class
mRNA
Alias
Euchromatic Histone Lysine Methyltransferase 2 KMT1C G9A C6orf30 BAT8 Euchromatic Histone-Lysine N-Methyltransferase 2 Histone-Lysine N-Methyltransferase EHMT2 Histone H3-K9 Methyltransferase 3 HLA-B Associated Transcript 8 Lysine N-Methyltransferase 1C H3-K9-HMTase 3 Em:AF134726.3 NG36/G9a NG36 Histone-Lysine N-Methyltransferase, H3 Lysine-9 Specific 3 Chromosome 6 Open Reading Frame 30 Ankyrin Repeat-Containing Protein G9A Histone Methyltransferase HLA-B-Associated Transcript 8 EC 2.1.1.367 Protein G9a EC 2.1.1.- GAT8
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_006709.5
Sequence length
3979.0 nt
GC content
0.6072

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1647.30 kcal/mol
Thermodynamic ensemble
Free energy: -1720.18 kcal/mol
Frequency: 0.0000
Diversity: 924.02
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((((((..((.((....)).)).))(((((..(((((....)))))..)))))..(((((...)))))((((((((((((((((((((((((.((..((...)).(((((((((..(((....))).)))))))))(((((...((....((((.(......).))))....))...)))))..((((((((.((.(.((((((((((((((((((((((((((((((.......)))))))..)))))))).((((((.((((((......)).)).)).)))).)).....))))....)))))).((((((((((((((((((((..(((..((..(((((...))).)).))....)))......)))))).)...))))))))))))).(((((.(((((((...((...((((((((.((........)).)).))))))..)).)))))))....)))))........))))).))))))))))))).))))))))(((.(((....(((((..((........))...))))).))))))..(((((.((..(((.(((.((((.((((((..........))))))......(.(((((((.(.((.(((.(((((....((((.(((((.((((((((........)))))).))((..((((........))))..))....)))))..))))...))))).))).)).).)))).))).)..)))).)))..)))..(((((.(......)))))).....)))))))..(((((.((((((((((((((((.(((((((((.((...((((..(((((.((....(((((.((((......((((.....(((((.(((.....))).).))))...))))..(((.........)))..)))).)))))..)).)))))..))))....((((((((.((((((((.((..(((...............(((.....)))..(((((((.((......)).))))))).(((((((((.....)))..........(((.........)))...(((((..(((((((((.....((((...(((((((((((((((((((..((.((((((.(((((....((.(((((((((...((((((((.(.(..(.....)..).).))))))))...)))))..(((((((.(((((.....)))))......)))))))(((((....)))))(((((((((........)))))))))((.(((((.(((((((((((((..(((((.(((......)))........(((....)))...((.(.(((((((.(((..((((((.((.(.((((((((((((.((((((((((((((..((......(((((...((....)).))))).......))..))))).))))))))).))))))........)))))).).))))))))..)))...)).))))).).))))))).....)))))))).))))).).)))).))...))))))..)).))).))))))))...(((.(((...(((..(((.((.((.(((((..(((((((((.(((.((((((...))))))))).((((((........)))))))))))))))..((((((..((((((....((..(((..((...)).)))..))))))))))))))(.((((.((.....)).)))).)((...(((((((((((((.((((((........)))))).)))..(((.((((..((((..((((..((((((((....((((((.(((.((((((....))))))..)))..))))))((((((((((((((((..((((((((.(((((((((...(((((....)))))....)))))))))((((.((((......((((((((......))))))))((((.((.((((((...(((((.......)))))...)))))).)).)))).))))))))(((((((.....(((((........))))).....))))))).......))).)))))((((.(((((.((((....))))..(((((.......))))).))))))))))))))).(((..(((.....((((((.....(......)....)))))))))..))).(((((.....)))))...))))))))))(((...((((((((((((((((((((((.........((.(((((..(((...)))..))))).)))))))))))....((((...((((((.(((.(((((((.(((...)))))))...((((((((((...((((((..((((((((((((((.(((((.....)))))(((...)))....(((......))).))))).......((((((((....))).))))))))))))))......((((((...))).)))...)))))).((((.((.((((((.(((.(((((...(((....)))......((((((((((((((((((.((.....)).)))))))...(((((((.....((((((((((((...(((.......((((((((..........).))))))))))....)))))))))))).....)).))))).....((.(((((......))))).))(((((((.(((.((((((((.((......)).)))))))).).)))))))))(((((..(((((((((((..((((........)))).)))...))))))))((((.(((....))))))).)))))...))).))))))))))))).).)).))))))))))))...........((.(((....))).)))))))))))).......(((.(((((........(((.((((....)))).)))))))).))))))..))).))))))...))))....((((((.(........).))))))..(((..(((((((.(((..((((((.(............(((((...((((......(....)......)))).)))))).))))))..............((((((((((((((.((((....)))).))).(((((((.((((...(((.((((((((((.(((((....))))).))).)).((((....))))....)))))..).))...))))))))))).....(((((..(.(((((((((..(((((.....)))))(((((((((.(((........))).))))))))).....(((....)))((((....))))..))))))))).)..))))).....)))))))))))....)))...)))))))..))).))))))))))))).)))..(((((........)))))((((((((((.((.((....)).)))))))))))))))))))).))).)...))))..))))...)))........................((((...)))).))))))))))...))..))))).)).))))).))).))))))(((....))))))))))..)))..........(((((........)))))))))))).))....))))......)))).)))).)..))))).......(((...)))..))))))..)))..)).)))))))).))..((((.((((.((((....).))).))))))))...)))))).))))))))))).)))).).)))))))..)))).)))))..(((((.((((((((..............(((((((((....((.....)))))))))))...)))))))))))))........))).))))))).))))))......((((.((((.((((..(((((............))))))))).)))))))).....))))))...)))......
Thermodynamic Ensemble Prediction
..(((,(((,(({..{{.||,.}}),})),{((((((..(((((....)))))..)))))|,(((((..,|||||({{{,{{|||||||,(((((((((.((..{{...}}.,{(((((((..((,....})).)))))))}|(((((...,{{,,.((((.(......,,))))...,))...))))),.((((((((.({{(.((((((((((((((((((((((({((({{{.,,....})))))),,)))))))).{{((((.(,((((......)).)),),.)))).}}.....))))....)))))),(({((((({(({{{((((((,,(({...,.||||{|,..})),)..,)....}))},,,,.|||||.....,)))))}}}}}})}.(((((.(((((({...{{...((((((((.((........)).)).))))))..}}.))))))}....)))))........))))).))))))))))))).))))))))|,|...,..}}}||||,,|||.,,..,.||{,.|.|((,|.,}}}..|||||,(({,({{,((,...((((.(((......))}.}))).,,{{,...|,{((((((.(.((.(((.(((((....((((.{((((.{{((((((........)))))).}}||}}|{{|....,,..,}}}..}}....}),)),.))))...))))).))).)).).)))).))}.}..))}},,||{{||({{{((((.{......,)))))}|...|||||,,..(((((.((((((((((((((((.(((((((((.({...((((..(((((.((....(((({.((((.,,...{(((...{.(((({.(((.....))).),}))).,.))))..,|{...,.....,}}..)))).}))))..)}.)))))..)))).{{,((({({((.((((((((.((..(((...............,,(,,...,)),.(((((((.((......)).))))))).(((((((((.....)))........,{(((.........))).,,(((((..{((((((((.....(({(...({((((((({((((((((({.((.((((((.(((((.,..((.(((((((((...((((((((.(.(.,(.....},,).).))))))))...)))))..(((((((.(((({.....}}))),.....)))))))(((((....)))))(((((((((........)))))))))((.(((((.(((((((((((((..((((({(((......))}........(((....))).,.{(,(.(((((,,.(((..((((((.((.(.(((((((((({{.{(({{{{((({(({..{|,{,,..{((({.,,((,..,||,|}|||,,,..,.}}..}))))}}})}))))).))))))........)))))).).)}))))))..,}}}}.)).))))).).))))))).....)))))))).))))).)})))).)),..)))))),.))}})).))))))))...(({{(((...(((..(((.((.((.(((((..(((((((((.{((.((((({...})))))})}.((((((........)))))))))))))))..((((((..((((((....{{..(({.,({...}).))).,})))))))))))))(.((((.((.....)).)))).)((...(((((((((((((.((((((........)))))),))}..,((|((((..((((.,{(((..((((((((....((((((.(((.((((((....))))))..)))..))))))(((((((((({(((,,{,({((((((,,{,(((((({{{(({{,.}},)))))....|||(((((....))))).}}}...((((((((......))))))))((((.((.((((((.,.(((((.......)))))||,}})))).)}.)))).,}}},.,,(((((((.,...(((((........)))))...,.))))))).{{..,.)}..)))}},|{,.|||||}||||....||}|{{(((((.{.{{{{|,,||{||||||||||||,,,.|||..,,,...}}||||||.}...|}...}})}}}.)))),,.,)}}),)}(((((.....)))))}}))))))))))){{{...(((((((((((({(((((((((.........((.(((((.,(({...})).,))))).)))))))))))....((((...((((((.{((,(((((((.(((...))))))).{,((((((((((...((((((,.(((((((((((({{,(((({....,|}}|}{,{..,||,...}|,..,,,.}}}),)}})).,,},..{(((((((....))).))))))))))))))......((((((...))).)))...)))))).{(({{((.((((((.(((.(((((...({{....})).,....(((((((({{{(((((((.{(.....,}.)))))))...{((((((.....((((((((((((.{.(((.((((({(.{,({{.........,.)})},}))))))...,)))))))))))).....)).))))),,,,,((.(((((......))))).))(((((((.(({.((((((((.{{......}}.)))))))).},}))))))))(((((..(((((((((({..((((........)))).}})}..,)))))))((((.(((....))))))).))))),},))).})))))))))))).).)).)))))))))))}...........((.(((....))).)))))))))))).}}.....,,.,,{,,...,(((.(((.((((....)))).))).)))}.,},})),.))}.)))))}...))))....{(((((.(.,,.....).))))))..(((..(((((((,(,{,.((((((.{............(((((...((((...,..,....,.,,...)))).)))))}.))))))....,,,.......((((((((((({((,((((....)))).})}.(((((((.((({.(((({.((((((((((.(((((....))))).))).)).((((....))))....))))),.}.}}.,}))))))))))).....(((((..(.(((((((((..{{(((.....})))}(((((((((.(((.......,))}.))))))))),....{{,,.,.{{|{,{{....)))))}))))))))).)..)))))..,,,)))))))))))....,,,...}))))))..))).})))))))))))).)}}..(((((........)))))((((((((({{((.((....)).)))))))))))))))))))).))).}...))))..)))}.,,)))........................((({...}))).))))))))))...))..))))).)).))))).))).)))))).|{....},))))))))..))}..........(((((........)))))))))))),))....})))......)))),,))).}..)))))....,.,{{,...,))..))))))..)))..)).)))))))).))..((((.((((.((({....).})).)))))))).,.))))))}))))))))))).)))).).)))))))..)))).)))))..(((({{(((((((({{,,,.,.,,,...(((((((((.,..(,...,.}))))))))))...}}))))))))))),,,.....))),})))),}}.}||||,....,||,,,,||},||.)))))))|,,,..|||..,,)))}}}}}|||||,,}}}....,)}))))}}})))......

Transcripts

ID Sequence Length GC content
CGGCCCCCAGCGCAAGCGGCGAUGGCGGCGGCGGCGGGAGCUGCAGCGG… 3877 nt 0.6056
Showing 11 to 11 of 11 entries
Summary

This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a , adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

Forensic Context

A review of cellular and animal models indicates that chronic exposure to drugs of abuse, including cocaine, morphine, and alcohol, alters the expression of the EHMT2 in the brain, where it functions as a histone methyltransferase writing the repressive H3K9me2 mark and is involved in cocaine-induced neural plasticity [Reid et al. DOI:10.3390/Ijms231911804]. A study in rats demonstrated that acute ethanol exposure induces an overall open chromatin state in the amygdala, associated with decreased levels of the repressive histone mark H3K9me2 and reduced protein levels of the histone methyltransferase G9a, which writes this mark [Krishnan et al. DOI:10.1038/S41380-022-01732-2].