Basic Information

Symbol
EIF3A
RNA class
mRNA
Alias
Eukaryotic Translation Initiation Factor 3 Subunit A EIF3-Theta EIF3-P170 KIAA0139 EIF3S10 TIF32 Eukaryotic Translation Initiation Factor 3, Subunit 10 Theta, 150/170kDa Eukaryotic Translation Initiation Factor 3 Subunit 10 EIF-3-Theta EIF3 P167 EIF3 P180 EIF3 P185 EIF3 Eukaryotic Translation Initiation Factor 3, Subunit 10 (Theta, 150/170kD) Eukaryotic Translation Initiation Factor 3, Subunit 10 (Theta, 170kD) Eukaryotic Translation Initiation Factor 3, Subunit 10, 170kD Eukaryotic Translation Initiation Factor 3, Subunit A Cytoplasmic Protein P167 Centrosomin Homolog EIF3, P180 Subunit EIF3a P167 P180 P185
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003750.4
Sequence length
6659.0 nt
GC content
0.4317

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1862.80 kcal/mol
Thermodynamic ensemble
Free energy: -1985.24 kcal/mol
Frequency: 0.0000
Diversity: 1615.77
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((..(((((..(((.((((.(((.(((....))).))).(((((((((((((((.((((((..((((...((((((((.((((((((.((((((......((((.(((...((..((.(((((.(((.((..((......(((((((........)))))))...(((((((.......((((((............))))))....((((((.(.(((((((((((((((....(((((((...................)))))))))))).)))....((((.(((......))).))))..((((((((((.((((...)))).))))...))))))...((......))..........((((((....))))))...........))))))).).))))))))))))).........((((((((.......))....)))))).((((((((((...((((((((((.((((.......))))))))...........(((((((.((.(((.((..............)).))).)).))))))).))).)))..))))).)))))...((((((((.......)))))))).(((((...((((((((((((...((((.((((....))))))))..(((.((((((....(((..((((...))))....)))(((((.((((....(((....))))))).))))).(((...((((((.......((((..(((.......)))..))))(((((.((((((.........(((..((...............))..)))..(((((((...(((...((((.((.....))))))......)))...))))))).))))))((((((((.......)))(((((.....)))))(((((.((((((((((((......(((((.((((..(((((((.(((................)))))))))).)))).)).....)))....(((((((((((((..(((.((((((.((.(((((..(((((((((.(.(...(((((.....)))))).).))).)))))).)))))..((((.((((.((((((((..(((..(((((.(((.((((..(((((.(((...((.(((((((((((.((((((...((.(.(((......((((.....))))...))).).))..(((....)))(((((((((..............(((((.((((...)))).)))))(((...((((......))))...)))......(((((.....)))))....))))))))).....((((((((((((.((((.(((((.....)))))..)))).)))..)))))))))......(((....)))..))))))))).)))))))).))((((..((.........((((...(((((((((((...((.((((.........))))..........(((((((((((((.((((((((.((((((((((((((((((((.(((((..(((((((..(((.(((((......)))))...)))....))))))).((((((.....((((((((....((((((.....(((((((..(((((...((.((((..(((((((..((..(((((.(((((......(((.......))).........((.((.(.(((((...((((((((.(((.(....((((((...............((((.....((.....))........(((((........)))))............................)))).((((......))))(((((.(((((((..((((((.(.........).))))))..)))))........)))))))..........((((.(((.......)))...))))..))))))).))))))))))).....))))))))..))..))))).))).))..)).))))))).))))..))...))))).))))))).....))))))))))))))((.......)).))))))..(((((((.(((.((((..((((((((...(((((((((.((((((..(((...........(((((.(((.(((.((......))))).)))...)))))...........)))..))))))..............((((((..((........)).))))))(((((((..((((((((......(((((((........((.(((((.(((..((..............))..)))))))).))....))))))).....................)))).)))).....)))))))..........))).))))))..)))))))).......(((......((((...)))))))......))))..)))))))))).((((......))))..))))).).))))).)))))))))))....((....((..((.....))..))....)).((((........))))................................))).))))))))((((..........))))......(((.(...........).))))))))))).)))))))..))))).))(((....)))...))))..))))...........))..))))..........(((((.......(((...........)))......))))).(((((..((((((..((((.......))))..))))))........)))))))).))))))))).)))...)))))....)))..))))))))))..)).))))((((.((((.(......))))))))))).)))))).)))))))))))))))).))))))))....(((((......)))))..)))).)))))(.((((((((((...................(((((.(((..(((..(.(((.(((((...)))))))).)..)))....))).))))))))))))))).))))))((((((...((((...(((((........))))).))))...))))))))))).))))))...))))))))))))))))))..))))))....)))))(((((...(((.((((((....)))))).))).)).))).........(((........))).))..)).)))...))))).))..)).))).))))......))))............))..)))))).)).))))))))(((.......))).(((((((..((.(..((((...(((..((((.(((((((.(...).))))..)))..)))).)))...))))).))..)))))))....))))..))).))).(((((.....))).))))))))))((((((..(((.(.(.(((.((((((((((...(((((.((.(((....))).))..))))).....(((((...((.........))...))))).((.((.....)))).))))))).))).....))).).).))).))))))......)))))))..((((....(((((((..(((.((((..((...))..)))).)))...)))))))....))))..)))).)))..)))))..)))))......(((((((((((((.((.(((((((((((((.....(((((((((...(((((((((((((((((((..........((((((.(..((((((((.((((((.(((.(((((....((((.........))))....((((((.((((.((...(((((((((.((((((((((..((((((.((.(((((((.(((.......((((((((((...)))).)))))).....))).))))))).((.((((.((...........)))))))).(((((((.((((..((((.......((((((((((..((((((.(((((..(((((.((.....)).))(((..(((..((((.((((....(((......)))....)))).)))))))..))).((((..(((((.((((..(((((......)))))....)))).))).((((((((.((.(((.((.........(((.................)))...........)).))).)))))))))).........))..))))...(((((((((..........((.....)).(((.....))).)))))))))(((((((.((......))))))))).)))..)))))...))))))(((......))).((((..((((((((((((.....(((((....)))))...........((((((((((............((((((.(.(.(((((........))))).)..).))))))((((..((((.((((((((((.....))).))).)))).))))...((((((((((((......(((.(((....))).)))..........................((((.((.(((....))).)).))))))))))))))))...))))((((((((..((((((.((((.((((.................)))).)))).)))))).))))))))((((((......((((((((........(((((((((((((.((((((...........(((((.((((((((((((...)))))))......))))).)))))............)))))))))))))))))))....((((...))))...(((((....))))))))))))).....))))))..........)))))).))))(((((((...)))))))(((((......))))).))))))))))))))))..........(((((........)))))..(((((........)))))))))))))))..))))...((((...))))((((((....))))))..)))).))))))).(((((((((((((....))))))).))))))(((((((....)))))))........)).))))))........))))))))))...))))))))).((((.....)))).....(((((((.((((..((((((((((.(((((((((((.((((.....(((((.(((((((.(((((((((..(((((((.........)))))))....)))))))))(((((((((((((((((((.................)))))).....)))))))))))))((((((((.........((((((.((((.....)))).)))))).........))))))))......(((((((((..(((.......)))..)))))))))((((((.(((.((((((...((((.......))))))))))))).)))))).(((..(((....)))..)))..((((((((((((...(((((((((...(((((.(.((((((((((((((((((.((.((((......((.(((((((...........))))))).)).........(((((.....((((((((((((.(((((..((((...(.(((((.(((....))).))))).).))))..)))))))).....((((((((....))))))))............)))))))))....)))))..(((...((((((....))))))...))))))).))....)))))))))))))))))).).))....(((((((((((.......)))))))))))........)))...))).)))))).))))).)))))))((((((((((...)))).(((.(((((((......)))))))))).(((.((((....)))).))).))))))............)))))))..)))))))))))))))))).))))).....))))).))..)))).)).))))).....))))))))))))((((((.(((.....((((((((((..((.(((.((((((.....))))))..))).))..).)))))))))..))).)))).))))))).))).)..))))).))))))))..).))))))...........))))).....)))))))..............((((....(((...(((.....)))..)))...))))((((........))))...))))))).)))))))))..(((((((.(((((.((((....)))).)))))....(((((((((((....((....))...((((.....))))...((((((....((.(((......))).))...))))))))))).))))))(((((.....)))))..........)))))))..((((((((..((......))..))))))))........((((((((((((....)))))))).))))......)))))))).((((..(((((....)))))..))))....((((....)))).)))))..))..))))))))..)))))...((((......))))..............((((((..((((((((...))))))))..))).)))...
Thermodynamic Ensemble Prediction
.((((({{((((({{({({((((.(((.(((....))).))).,,(((,(((((((((.((((((..((((.((((((((,,,(({,(((.(((((.{{.....(((,((,.((((((((((((((...((((((((.......(((((((........)))))))......(((((......((((({.....,,,,,,,||||}}.....,},||||({({,,.(((((((,{{(,.,.(({{.....))))..,,))))))}))))))..,,{,..,,,,..((((.(((......))).))))..{{{{{||||{.||||..,)))),}}}),,,))}}}}))))){{{.{{{{.{{|||,...,,,||||,.,|{|}|||||,.....(((((((({{{,{(((((.((((({((({(....{((((({{.......,}....)))))}.((((((((((,,{{{((((((({({{{{....,,,)))}}||,.....,,....{((((((.((.(((.((..............)).))).)).))))))),)}}.)))..})))).))))).((((((((((.......)))))))))))..{((((((.,,((((,.,,,{(({{((((....)))))))),.))))))))))}.}}.))))}})))}))))},},))),|||{{,||||....{{{....}}}}}||,|||||(((({...{(((((.....{((({..{({.......))).,))))).|,|..,}},.......))))).......,,,,.....)))))))).....(((({{{..,{({...}}}|,,,|||||}.))))))}||,||...,))))}},...)))))))).)))......(((((((((.....)))))})}))..{((((((((((......,,,((.((((..(((((((.(((................)))))))))).)))).))...,{|,,...{(((((((((((((..(({.((((((.((.(((((..(((((((((.{.{...(((((.....))))),.,.))).)))))).})))}..{(((.(({(,((((((((..(((,{(((((,(((,({,,..((((({({({,.((.,,,{(((((,.{((((,{.,,((,{{({{,,,...((((.....)))){{,|{|{|{|,......{{.,|{(((((((({.....{(((,((,{(((((.((((...)))).)))))|,}}}.,|||...,...}}}|||}||......((,,(,{{{{|||||..,{||||}|}}|{{{,,{(({((((({((.((((.(((((.....)))))..)))).))}..)))))|||{......|||,...|||{.,}||,.|||.,(||{|.|{|...|}}}})))....},,..||.||||{{{{(((((...{,.||{|{{{{{{{{{{{{,.,.,,..,{{({{{{|||(((({.,(((((({,(((((({(((,{,((((((((,,,,|}}(((((((..,((.({(((,,....}}}}),,,}}},,,.)))))))..,,,,,.....((((((((....((((((.....(((((((..(((((...((.((((..(((((((..{{..(((((.(((((...,,.(((,....,.}},.....,...,{.({{(.(((((.,.((((((((.(((.(....((((((,..,,..........{{||.....,|}},,}........{.{((({......,,)))))}.|||,....|||.....,{{.,,....|,||.,{{|,.....||}}({{{{,{{(((((..((((((.(.........).))))))..)))))........})))))}.........{((((.{{{.,.....))}...)))),.}}))))).})})))))))).....)))))})},.)}..))))).))).))..}}.))))))).))))..))...))))).))))))).....))))))))))))))((((((((..{...{{{{{,.....,..,(((((((....))))))}......,,{...{(((((..(((......,,...(((((.{(({({(.((......))}),,)))...)))))...........)))..))))))..............(({{..........}},..,.))))))..}..)))))))},.((((....)))),,,......}}||}|{|||}|}}}}||}}}},....,,..,))}}))))))).,|}.....}}})},....,,,}}.))}}....,}})))}..,})}..,,)),))))..,}....,,,}},..|})).,|,..}}))},,}}),.}),,,,..||}}}}.)))}},,...||{||,,.}))))||||||.{(((......))))}})))|||,..,|,|{{{||||.........}}.}}}))}.||....,},},,.....,}.((((........)))).,,,}..},}.}},,,..........,,,}}.}))}))},}}}}{{{{..........))))......(((.{...........),)}))},}}}}},},,,,}|,,}}..,.))|{{....))}})})))).}))}}...........,,..})))||||,.....,{{((...,,,,{((......,....|||||,,.|}}},|,{{({{{.,,,,.,..,.||}.,},...,)),}))))))}....,,,}))))))).)))))}))).))),,.},}}}....)))..)))))))))),.,}.))}}((((.((((.{......})))))))))).)))))).})))))))))))))))},,,|.,,,....{((((......))))}......(((((((((((((((((((((.(((....(((.(.((((({({(((..(((..(.(((.(((((...)))))))).)..))).,.,,)).))})))))))..))).))))..((((((...((((,..(((((........))))).))))...))))))(((.{..{,{....,.})..).))).))))))))..,,,((|,{{,.,.|||},,,..}|}.||||||.}}}})}}}..||,.((((((,..,..{,.(({.....,..|,,....(((((.....)))))..,..|,.}...,,.))....,}))),.)),.,.....))})))))))))))))))))}((((.....,.)))).)))|)}})))))...)).)))..}..,.}})),))}.)))..)))..))}.)))))..))))..)))}})).(((((.....))).))})))))))|,|||.,{(((...,.|||.||||||||||{((({{,,(((...{.|||.{{((((((((..,(,{(({{{.{{(.,,.|||,,|..|||},..,,.{|{{|,,,{||........}},,.}))}).|{.{{.....}}.).)))))))},)).....))).,,}.}},.))))))......,)))))){{(,{{.|}}(((((((.{(((.((((..({...))..)))).))).}.))))))).,)}))),.})))).,))}})))))}.},,,}......(((((((((((((.((.(((((((((((((..{,,(((((((((...(((((((((((((((((((..........((((((.(..((((((((.((((({.(((.(((((....((((.........)))).,..((((((.((((.((...(((((((((.((((((((((...{{{{{....(((((((.(((.......((((((((((...))))},))))).....))).))))))),((,,{{{.(({{.,{{{{...||||||||.{{{{{{|,{{{{..((((,{{,...((((((((((.,((((((.(((((,.(((((.((.....)).}}|{{.,{{..{((((.((((..,,(({....,,)))....)))).))))){{,.(((.((((..(((((.((((..(((((,...,,)}))),...)))).))),(((((((((((.(((.((.........(((.....{......,....)))...........)).))).)))))))))).,.......))..)))).)))|||{{{{{.....{{({{((,{{{..{.{{,.,...,,,,)})})},))|||||||}||......|}}}}}}||.))).|)))))...))))))|||,,....)},.((((,.{(((((((((((.....(((((....})))).........,,(((({{((({.,.,,.......((((((.,.{.(((((........))))).)..).)))))){{{,..((((.((((((((((.....))).))).)))).)))}...((((((((((((......(((.(((....})).)))..........................{{{{.((.(((....))).)).})))))))))))))))...}}}}((((((((..((((((.((((.((((.,.............,.)))).)))).)))))).)))))))),{{{{,......((((((((,,,,...,(((((((((((((.((((((...........(((((.((((((((((((...)))))))......))))).)))))............))))))))))))))))))),}..(({|...,}}}...(((((....)))))))))))))...,.}}}|||,||,.....,)))))).}}}}{(((((,...,))))))(((((......))))).))))))))))))))))....,,....(((((........)))))..,{(((,...,,,,)))),)))))))))),||)}}...,(({...,))|((((((....)))))),.)))),))}}}}|.(((((((((((((....))))))).)))))),||{{{{{{,,||,}),},....,))))},)))).,,,.})}.))))))))))...))))))))).((((,...,)))).,,..(((((((.((((..((((((((((.(((((((((((.((((.....(((((.(((((((.(((((((((..(((((((.........)))))))....)))))))))((((((((((((({{(({({,{............)))))})).....)))))))))))))((((((((.........((((((,{(((.....))}),)))))).........))))))))......{((((((((..(((.......)))..))))))))|((((((.(((.((((((...{{((.....,.))}}))))))))).))))))},.,..{((....}}}..}}},,((((((((((((...(((((({((.,.((({{.(.((((((((((((((((((.,{,((((.,,.,,||,|((((({.....,,.,,,})}||||,}}.........{{{{{..,..((((((((((((.(((((..((({.{,{.(((((.(({....}}),)))))})}))))..))))))))..,,,((((((({....))))))))..,,,.......)))))))))....}}}}},,{{{...((((((....))))))...))))}},.,}....)))))))))))))))))).}.},....{((((((((((.......)))))))))))....,...)))...})).)))))).))))).)))))))((((((((({,,,|}}}.,|||{{{((({......}))))}||||,(((,(({{....)))),))}.))))))............)))))))..)))))))))))))))))).))}},...,}))))).))..)))).)).)))))}}...))))))))))))((((((.(((...,.((((((((((..((.(((.((((((,...,))))))..))).))..).)))))))))..))).)))).))))))).))).}..))))).))))))))..}.))))))...........)))))},...,}))))}......{(((....)))}....,{{...((({....,,)}}),,.,,((((.........))))),....))))))).))))))))}..(((((((.(((((.((((....)))).)))))....(((((((((((....{{.....,...((((.....))))...((((((.,,.((.(((......))).)}...))))))))))).)))))){((((.....))))}..........))))))),.((((((((..{{......))..)))))))).,......,,{,((((((((....)))))))).,,})},....)))))))).((((..(((((....)))))..))))....((((....)))).)))))..)}..))))))))..)))))...{((({,,,,,,|}}...........,}}||||{{..((((((({...})))))))..)}}..,,...

Transcripts

ID Sequence Length GC content
CCUUUCCGUCUCUGGCCGGCUGGGCGCGGGCGACUGCUGGCGAGGCGCG… 6659 nt 0.4317
Summary

Enables RNA binding activity. Contributes to translation initiation factor activity. Involved in IRES-dependent viral translational initiation; formation of cytoplasmic translation initiation complex; and viral translational termination-reinitiation. Located in cytosol; nucleolus; and nucleoplasm. Part of eukaryotic translation initiation factor 3 complex. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in mice demonstrated that the EIF3A was down-regulated in kidney tissue at 8 hours (0.601-fold) and 24 hours (0.547-fold) after whole-body irradiation with 10 Gy γ-rays, and similarly down-regulated in brain tissue at 8 hours (0.570-fold) and 24 hours (0.535-fold) [Zhao et al. DOI:10.1158/1078-0432.CCR-05-2418].