| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGGCAGCGAGAGGUUCGCGGGUGCAGCGCACAGGAGACCAUGUCCGGG… | 827 nt | 0.6288 |
This gene encodes one member of a family of translation repressor proteins. The protein directly interacts with eukaryotic translation initiation factor 4E (eIF4E), which is a limiting component of the multisubunit complex that recruits 40S ribosomal subunits to the 5' end of mRNAs. Interaction of this protein with eIF4E inhibits complex assembly and represses translation. This protein is phosphorylated in response to various signals including UV irradiation and insulin signaling, resulting in its dissociation from eIF4E and activation of mRNA translation. [provided by RefSeq, Jul 2008] CIViC Summary for EIF4EBP1 Gene
A study in *Phormia regina* maggots identified the EIF4EBP1 as an RNA marker differentially expressed between feeding and wandering behaviors specifically at 120 hours post-hatching [Lin et al. DOI:10.1371/journal.pgen.1011948].