Basic Information

Symbol
ELANE
RNA class
mRNA
Alias
Elastase, Neutrophil Expressed HLE Neutrophil Elastase PMN Elastase Medullasin PMN-E ELA2 HNE NE Polymorphonuclear Leukocyte Elastase Bone Marrow Serine Protease Elastase 2, Neutrophil Leukocyte Elastase Elastase-2 Granulocyte-Derived Elastase Polymorphonuclear Elastase Human Leukocyte Elastase EC 3.4.21.37 EC 3.4.21 SCN1 GE
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Mechanical injury analysis

MANE select

Transcript ID
NM_001972.4
Sequence length
909.0 nt
GC content
0.6667

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-407.20 kcal/mol
Thermodynamic ensemble
Free energy: -420.92 kcal/mol
Frequency: 0.0000
Diversity: 321.34
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((..(((((((((((((((......(((((..(((.(..((.(((((((((......(((...((((.((((((((....((((((((((((.((.(((((((...(((.(((((((((((((.....(((((......)))))))))))))))))).)))..)).((((((.((((....))))))))))(((((((.....(((.((.((........)).)).)))(((((((((((((........)).))))))))))))))))))..((((((........))))))))))))).)))).))))))))......)))).)))).))))...)))..((((........)))).............)))).))))).))..).)))....)))))(((((((....(((....)))...)))))))........(((.((((.((..(((((.(....).)))))..)).)))))))..))))))))))..)))))((((((.(..(((.....)))..))))))).((((......((((((((((.(......).)))))))))).(((.....)))..(((((.(.(((.((.((.((((((.(((((((((((((..((((..(((((.(((.....))).)))))......))))...((((((((.....))))))))((.(((((.((((.................)))).)).))).))..........(((((.((.....))))))).......(.(((((.....))))).)..)))))))))..)))))))))).)).)).))).)))))).((((.((..(((...)))..)).)))).........))))((((...))))............)))))........
Thermodynamic Ensemble Prediction
,(((,..((((,((,{{,(((({.{{,.({{,(..((({(,.((,,((((((,,......,||}..|{||,{{|{||||}..,,{{|||||||||.,,||{||||,|}}((({(,((((((((((({{{{{(,(,({{{{..,|}||||||||||,||||{|||,{((.{{.,{({(((({...}))))))|{,(({{{{{.....(((,({.((........)).)),)))(((((((((((((........)).)))))))))))||||}||{{(,(((({.......||||||,.,)))}})|||.,|||||||.{{...||||{,,,,,|,,,...)),..}}||}..,(,,,||||......{.,..,,|}},.))))).,,..,,)},..,,)))))(((((((..,.(((....)))}..)))))))}}.}}}}}||,.,,||},,{{((((,{({{,.}{|||||{,}}.||||}||,.||||}}}}))}}}}))){||||,.({((((,...,|||.{|||||||,{{,{......((((((((((.{......}.)))))))))),({,....,))).,{{{|{.|}|||||{,({.{(((((.(((({{,,{{{||}}.||||}(((((.(((.....))}.)))))...}},))),...{(((((({.....))))))))}|}|||||.((((,,......},.}},,,})))).))}))).||{{,....,,,|((((.((.....))))))}..}}}}},}||||,,,,,.,||||{...,,,,))))).,)),}}))))).))})).}})}))),))}||||}||,.|||}}.)))}.))}))))...}}}}}}.)))}|,(,..,,,),,,,...,{{,.,,,,)}},,,,,.

Transcripts

ID Sequence Length GC content
AGAGACCCCGGAGCCCCAGCCCCACCAUGACCCUCGGCCGCCGACUCGC… 909 nt 0.6667
Summary

Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode structurally similar proteins. The encoded preproprotein is proteolytically processed to generate the active protease. Following activation, this protease hydrolyzes proteins within specialized neutrophil lysosomes, called azurophil granules, as well as proteins of the extracellular matrix. The enzyme may play a role in degenerative and inflammatory diseases through proteolysis of collagen-IV and elastin. This protein also degrades the outer membrane protein A (OmpA) of E. coli as well as the virulence factors of such bacteria as Shigella, Salmonella and Yersinia. Mutations in this gene are associated with cyclic neutropenia and severe congenital neutropenia (SCN). This gene is present in a gene cluster on chromosome 19. [provided by RefSeq, Jan 2016]

Forensic Context

A study in human sepsis patients demonstrated that the ELANE is upregulated in peripheral blood and its high expression is adversely associated with 28-day survival [Li et al. DOI:10.1515/biol-2022-0999]. A study in humans identified the ELANE as one of 19 center genes commonly differentially expressed in blood across early-stage (<11 days), middle-stage (11-49 days), and control groups following burn injury, indicating its association with burn injury progression [Wu et al. DOI:10.007/s10753-018-0829-0]. In mice, single-cell RNA sequencing following traumatic brain injury with clodronate pre-treatment revealed the ELANE as a defining granule gene for a neutrophil-like monocyte cluster, with its expression increased in whole blood monocytes; the emergence of this subset correlated with neuroprotection, including reduced lesion volume and improved cerebral blood flow [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8].