Basic Information

Symbol
ELAVL1
RNA class
mRNA
Alias
ELAV Like RNA Binding Protein 1 HuR MelG Hua ELAV (Embryonic Lethal, Abnormal Vision, Drosophila)-Like 1 (Hu Antigen R) Embryonic Lethal, Abnormal Vision, Drosophila, Homolog-Like 1 ELAV-Like Protein 1 Human Antigen R Hu Antigen R Hu-Antigen R ELAV1 HUR
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_001419.3
Sequence length
6054.0 nt
GC content
0.4632

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1839.60 kcal/mol
Thermodynamic ensemble
Free energy: -1959.63 kcal/mol
Frequency: 0.0000
Diversity: 1941.54
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((...((..((((((((.(.((.((.((.((.((....)).)).)).)).)).).)))..)))))..)).)))))((((((((.(((((((((((((..((((((...((((...(((((......))))).....((((..(((.......))).))))...(((((((.......))))))).....)))).))))))....)))))).(((((((((((((((.(((.(((((((((((......(((.(((((((((.....((..(((((((..((....))..)))))))..))..))))))))))))........(((((.(((((((((((...((((...((((..((((((((((.((((((.((.....(((((((.....(((((((.((.((((((.((((((((...........((((((...((.((((((.......).))))).))..))))))..........((.((((....)))).))(((.((((.(((.((((((.......))))))))).))))))).(((((........(((((.(((((.((((.((((((...))))))))))))))).)))))...)))))((((...))))((((((.((..(((((((.....((((.......))))..........(((((((..(((...((((((..(((((((((((((..((((((...............((((.((..((.....))..)).)))).(((((((....(((...((((((((((((((......(((((.((((.......))))((....))))))).......)))))))).((.((((((......))))))))...)))))).))))))))))................((((((.((((((.....(((((((((((((....((((((.(((((...(((((....)))))((((((((((((.....(((...(((((..((((((.((((((..((((.(((((.......)))))...(((((.(((((....(((........)))....)))))...(((((..(((.....)))..)))))...)))))............((.(((((......((....)).....)))))..))(((((((((((..(.((.(((((((....((((((((.((((((((.....((((.......(((..(((.((((.....((((..(.(((((..((((....((((((((.....(((.(((((((.....((((((((((((((((....(((((((((((.((......((((.(((((((((..(((.((......)).)))..))..)).))))).)))).....))))))))((((.((((.....)))).))))((((..((((..((.(((......((((....((((((((((...............((((....)))).((((............)))).....((((((........)))))).))))))))))..((((((((.(((.....(((((((...((((((((....)))))).))...)))))))..(((((.....))))).(((((......)))))......))).))))))))((((((....(((....)))))))))......((.((((((((((((((((((((.....((.((((...)))).)))))).)))))))))))))))).))))))..((((((....)))))).))).)).))))))))..)))))..........(((((((...)))))))..........((((((((........((((((((..((.((..(((((((.((.((((.(.....).))))....))..))))))).)).))((((....(((.....)))...))))(((((..((.(((.......))).))..))))).........))))))))........))))))))................))))))))))))).))).......))))))).......))).....))))))))))))..))))).))))).....)))))))..))).......))))))))).)))))))))))....)))))))))))))))))))))..))))..))))))))))))........(((.((((((((((((((........))))...))))......)))))).)))...........................)))))....))).....)))))))))))).((((((....((((((((...........)))))))).))))))......((((((((((((((..((....))..)))))))))).)))))))))))))))...))))).(((....)))....(((((.......((((.....)))).....)))))...(((((((((((......))).))))))))(((((.........)))))(((...(((((..(((((...(((...((((((...)))))).(((........))).....((((.((((((((((((((.........(((((((((...((((..((..((((....(((..((((..((....)))))).....)))....))))..))...(((....)))...))))...))))))))).(((....)))..((((((.....(((((.((((.(((((((...((((.(((......)))))))))))))).....(((..(((...((.((((.((((((((((.(((((((.(....((((((.....(((.....(.((((....)))).)))))))))))))))))).)).))).))))).))).).))...)))))))))).)))))....)))))).(((((.((((((..............))))))))))).(((((((....)))))))....))).))))))).)))).))))..........(((.(((.....))))))((((((((((...((((((..(((((((........)))))))...((((.(((....))).))))...(((((.....(((((((...)))))))(((((((...(((((((((.(((((((((........)).))))))).)))))))))((((((.....(((((((.(((((((((........)).))))))).))))))).((((..((.(((((....((.((((.((((((((((.((......)).))).(((((((...))))))).(((.(((((....))))).)))))))))).......((((((((((.....((((((((((.((.(((..((....((..(((((((((....(((((((((((..(.(((.(((((..(((((((((...((((.((((..........)))).))))..)))...))))))))))).))).)..)).)))))))))..(((.(((((.((((.(.....).))))))))).))).......(((.((((...(((((....))))).....(((((((...(((((((((......(((.((((....)))).))))))).)))))...)))))))..(((((((((..........(((((.((..(..((.....))..).)))))))((((.((..........................)).))))..........(((..((..((((((.....)))))).))..)))..((((((...))))))...............)).)))))))...............(((((((.((...)).)))))))(((((((.((((...(((((.((((((...(((((.......))))).....)))).(((((......))))))).))))).)))))))))))....)))))))((.(((((.((...)).))))).))..((((.(((.................))).))))..((((........)))).....((((...)))).....)))))))))..)).....)).))).)).))))))))))))))))))))....((((((((....)))))))).)))).))..))))).))..))))...((((((.((((.(((((((((((........))))).(((((((....)))))))...))))))))))))))))..))))))((((((((((...)))))))).))........(((((((.((((..((((((.....)))).)))))).)))))))((((((((((((.......))))).))))))).(((.(((.(....(((.(((......))))))..).))))))..)))))))(((((.....))))).........((((((.(((.....((((((.((.....)))))))))))..))))))((((((.....))))))....)))))...((((((((((((.............(((((((((..(((((........((((......))))........)))))..))))))...)))............))))).)))))))..)))))).))))))))))......((((....))))....(((((((........))))))).))))))))...)))))..))).)))))))).)))))))))))).....((((((((...)))...)))))..(((....)))...(((((((((((((.....))))))))))))).)))))).)))....))))))))))...((((((.....((((...(((((..((....)).)))))))))....))).)))..)))))))))..)))))))......((((((......))))))...........))))))).....)).)))))).....)))))))).))).........))))).)))))))..)))))))..)).)))))).)))......(((((((......)))))))..))))..)))..)))).))))...))))))))(((((((((((((.............((.(((((((((.....))))))))))).)))))))))))))((((...))))...((.(((.((...)).))).))........))).))))))))))))))))((((...))))....((((......))))...))).))))))))))...)))))..(((((.((((((..((((((.(((((((((...(((((((......(((((((.((.(((((...(((........(((....)))((((((((((((....(((((...(((..((((((((((((...(((((............)))))...))))))..))))))..))).))))).....................((((((((((((.((((((.............................)))))).))))))))))))..(((((.((((...((........))..)))).))))).))))))))))))..(((((......))))).((((((..........((((.(((((((((......))))))))).))))..))))))((((((((.....((((((((((((((.(((((...(((((............)))))...)))))..))))).))))..)))))))))))))))).)))))..)).)))))))))))))).))))))..))).))))))....)))))).)))))(((..((((...(((.(((((((......))))))))))..))))))).)))))..))))))))))(((((((((((..(((......)))((((((((.((......))...)))))).)).(((((((((.((.....))))))).)))).)))))..)))))).............(((((.......)))))))).
Thermodynamic Ensemble Prediction
(((((((((((...((..((((((((.(.((.((.((.((.((....)).)).)).)).)).).)))..)))))..)).))))))}}))))...{{{.,..((((((,,,,,((((.......)}))((((((((..(((((((,......{((({...{{.(((((((((((((((((({,{.,{((,((((,,,{,{{{{((((((((((,,{((((,{{{{......)})),..{{{{|||{,(({{{,.,{{.((({(({((((((,{,,{(({.(((((((.,{..,{,|,..||||,,|{{{{...|||||||||||.,...||,|,}},,,,}||||}.}}}}},)}|||||||..||,|||..,},}},||{,|||||||,{{||,||,{{{.,|||{{|||({||(,((|{|..{{{,...,{{.....((((((...((.((((((.......).))))).))..))))))..,,{{{,,.,{.((((....)))),||(((.((((.(({{((({((.{.....})))))))).)))}}))({((((,,,.....(((((.(((((.((((.((((((...))))))))))))))).)))))...,}}||({,,,.({{{((((({(((({,...({(({....,{{{,,,,,..}}}}......,{{{{{{{{{||||||||||,.{|,..{||{,|||||||{{{{.{||,..,,,,.......,,{|(({.{,,{{,((((.((((........|.)))))))).||...|||||||{|||{({......(({({.((((.....,.}}}}{{,..,}}))}}},......}))}}))),{{,((((({......}))))))}...)))),),},)}||||||,.....,,,....,,,||||||.({{{(({{,..(((({{{{}}}||||},,,||,||{|||}|}|||{{|,,}{|||,,,,||||{{||||,,,||{{{...,{{{,.,{,{{|||({((((|,{{((|{(({{...,,,.}}}},.||{{((({{(({(,,..(((..,,|||,|},....}))))...|||{(|((((,....|||,..,|||{{.,,,.,}}}}}.,,,,|||||(((((......((....))..,,.)))))..||(((((((((((..{.((.(((((((....((((((({,((((((((.....((((...,.{.{((..(((.((((.....((({..(.(((((..((({...{((((((((.....({{.(((((((.....((((((((((((((({.........((((({,((......((((.((((({({(..(((.((......)).)))..))..,}.))))).)))).....)))))))){{{{.((((,.,..}})).|||}((((...(((..((((((..............((((((((((.,{,,{..{.,,,.,(({{....}))}}))},.}}............}|||,,,(((((........)))))}.))))))))))..((((((((.(({.....(((((((...((((((((....)))))).))...)))))))..(((((.....))))).(((((......)))))......})).))))))))..(((((..(((({{{((((((((((....((((.((((((((((((((((((((.{,..,|,((((...}}}}.,,)))).)))))))))))))))).))...,..{{((((....)))))))))...)))))).)))}...((((((.{(....(((((((...)))))))..)}.)))))){((,,....,},..})))..)))}.)))))..(((((((.{,.((((.{.....,.))))....},,.))))))))))))).}))}}}}|||..,,.,))...,}||{|||,,}||,,.,.,,...{{{{{((({{{((..........))))))))}}}.....,,},|((((.{{.....}}.))))))))))))))))),,)).......))))))).....,.))).....))))))))))))..))))).))))).....)))))))..)))}....,.))))))))).)))))))))))....)))))))}))}))))))))))..}},,...||||||}}}}|,|||,...|||,||,{,,}}||||,,.,}}}}},}|||||.,,|},.,,||||||||{||||{{.{|{..{,,{{|||||||,,,,,,|||||...,||,,||..}}}}}}}})))}..{{|||,{,.{{{{{{{{.........|,|}|||}||,},,|||{{{{{,.{{{((((((((((,,({....||,,}||}}}||}|,{{{{||{{{|||{|{{.|||{{({{((.,..}},.,,..,,.,,,...,}||||,,...||}}..},.,,,,},..{((((((((((......))).)))))))}{{{{{{{{{,,,..,,,))|||||.||||||||||}||},,}}},,((((((...})))))|{.(((((((,.{({{...,({{..,)}}.})))))))))).},....,,,..|,,|||,,{||||}|||}.|||,}}||||||}},|||..{{{||||||...,{{{{{|{{{{.........)))}..,,{||||||||||,,,{||||||||||,,..}}}.}||||||},.,.,,{{{.{{{{,{((((((...{{,{,(,,......})},}},)))))))..,|.(({{{{(({{{({((({(.((((((((((.(((((((.(....({((((....,((,,,...,.{{.|,.}}),,,}})),)}}}}),))))))).)).))).))))).)})|}|{|{{,||}}|||,...|||||||..},)))).((({{{((((((...,,......,,.))))))))))).(((((((....)))))))......,..,,...{{|{{|{.||....,||....{{{.|||....,))}})),}},,.,.,....)}))))},||||{||,,,,,..,)))))))))))),}}}|{{{{({(((,{{{{{|,|,||,....(((((((...)))))))}}}}||{,..|||{|||||,.|||||||||,.,,,..{{,{{((({|.|||||||||,{.,||..|||{{(((||.|||||||||{{.,||..||,|||||||.|||||||||||.,||..}},||||||}.})))))|(((((({{{.{|..,,,,}).))),||(((((...))))))}.(((.(((((....))))).)))))))))|{((({{.(((((..(((.....(((((....))))).....)))....)))))...||{{,,,.((((((((({(..{.(((.(((((..(((((({((,..((((.((((..........)))).))))..)))...))))))))))).))).)..)).)))))))))..(((.((((((((((.{.....}.))))))))).)))}}}}}))}))))}.))))(((((....))))).....(((((((...(((((((((......(((.((((....)))).))))))).)))))...))))))).......,}}}},)))}).,,||||,|||.,|}}||,.)}}))}}..)))))))))}}}))))))}|,,..,{{{{{{{{{,....,,,,(((((.((({.{((((((....))))))}...,}),.)))))........((((({...})))))............{{{,{{{{{{,({{{{{{{{{..{{{.,{{{{{,{|||..,||{{{{||{{{{{,,,,{{{|(,{,|{{((.,,{{((.,,(({((,,,,,,,}||||,,.,,||||{{((((,.....))))},|||}|||,}}||||}}|,,..,,|,,,.{|{||{{{{|,|||||)|.}))))|||,,{{((|{({,.,{,.,,||,}|....})}.}}}},,||||}}.,,,,,|}}},..,,,|||||{{{{{{{{..,{{,,{{{{{.({{....((({{({{((((....))))))))))..})),,.{(((((((....)))))))),..,{{....||||||||{{.,(({..((((({,((((.(((((((((((........))))){(((((((....))))))),..)))))))))))))))).)))..,.((((((((((...)))))))).))........(((((((.((((,,,,((((.....)))),),)))).)))))))((((((((((((.......))))))))))))).{{{.(({{({{,,{({,{{{,.,.,,|||||}..}},)))))}}}}|,,||||||,}}|}})}},,,|||,,...{,|||||||||||},||{|||,||,,...))}}}}})}|}..}}}}}}{,,,,|.,}}})}}}}|{{{{,,((((..((((((((((((........{{...(((((((((..(((((........((((......}))).,......)))))..))))))...)))..,.........))))).)))))))..)))},{|,}.},|)))}}}},|,||||.,,,))))}}}.(((((((........)))))))......,},,...,,,,..,...,}||||||,|,}}}}||||||,.,..((((((((...}))...)))))..|{|,...))).,.(((((((((((((.....))))))))))))).((((....,,.))))..{{{{{||..,,.|||,,{|}}||,{{{{{{{||..,||,,{||||||,}}||}.|,,|||||{,,,|{||||,,|{||||,,,|{||.,,(((((({((,((((({{,,......{{{,....}})),....},,})}))}....}).}})))))).,,})))))))..}}..},,,}},))}}))))|{|||,{|{|,|{{|},,,,,|||{(({......,}))},....,,|||||(((((.(((..((..((({...})))))..))).)))))..|}}||,.,((,,{{{{{{||,,,,,)}))))))))),..,,,||{{{{|,|({|{{.{{{{{,,..{{{.,,.{{.((,{{{{.....,.))},},)).)).,,)))}))))))),))}})},..}))))}}...{{{|.|||||||.,||}|||,.,}})},}}))}}},||}}}|},..{{{{{{{{{,,.{{{{,,...},}})))))}})},||||||}||}|||||,|||,,........{||,..,}}}||||||{{{{||,,,,||{{|.,.(((..((((((((((((...(((((............)))))...))))))..))))))..))).}}}},.,.{{,,{|,...........{(((((((((((.((((((,........{,,........},.....),)))))).)))))))))))}..(((((.((((....{,.....,,.,..)))).))))),))))))))))})},|||||},,,..,,}},.{(((({..........||||.(((((((((......))))))))).}}}}..))))||{|||||||..,,||||{{{{|||||{|||,,|||}}|||||.....},,,}},)))},..,))}},,,})))),))},.})))))})))}))}))}})))))}.,}.)))},,,((({....))))...,.))))))))))).)))))))).}}.))))}.,(((...(((.(((((({......})))))))))..)))).)))))))...,))))).)))(((((((((((..(((......)))((((((((.{(,.....}},,.)))))).)).((((((({{{({.....,)))))).)))).)))))..)))))).,,{{,,.....,.,,,..)))))).....))).

Transcripts

ID Sequence Length GC content
GUGCGCGCUGAGGAGGAGCCGCUGCCGCCGUCGCCGUCGCCGCCACCGC… 6054 nt 0.4632
Summary

The protein encoded by this gene is a member of the ELAVL family of RNA-binding proteins that contain several RNA recognition motifs, and selectively bind AU-rich elements (AREs) found in the 3' untranslated regions of mRNAs. AREs signal degradation of mRNAs as a means to regulate gene expression, thus by binding AREs, the ELAVL family of proteins play a role in stabilizing ARE-containing mRNAs. This gene has been implicated in a variety of biological processes and has been linked to a number of diseases, including cancer. It is highly expressed in many cancers, and could be potentially useful in cancer diagnosis, prognosis, and therapy. [provided by RefSeq, Sep 2012]

Forensic Context

A study in rats and mice demonstrated that the ELAVL1 protein level increases in whole brain following seizure and cocaine treatment, shows increased dendritic localization in the hippocampus and cortex, and its levels are decreased in a dopamine transporter knockout mouse model [Tiruchinapalli et al. DOI:10.1111/J.1471-4159.2008.05718.X].