Basic Information

Symbol
ABCB11
RNA class
mRNA
Alias
ATP Binding Cassette Subfamily B Member 11 Bile Salt Export Pump PFIC-2 ABC16 SPGP PGY4 BSEP ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 11 Progressive Familial Intrahepatic Cholestasis 2 ATP-Binding Cassette Sub-Family B Member 11 ABC Member 16, MDR/TAP Subfamily PFIC2 Sister P-Glycoprotein EC 3.6.3.44 EC 7.6.2.- EC 3.6.3 BRIC2
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Drug abuse diagnoses

MANE select

Transcript ID
NM_003742.4
Sequence length
6934.0 nt
GC content
0.4442

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2113.20 kcal/mol
Thermodynamic ensemble
Free energy: -2245.81 kcal/mol
Frequency: 0.0000
Diversity: 1953.18
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((.......(((((((((((((((....)))))))).......((((((((.(((((((((((..((((((((((((...((((.....(((((((.(((((((((((.............((((((((((((...(((((((((...........))))))))).............)))))))))))).(((((......))))).........(((((.((.((((((.....(((((.((((.((..(((((((((((((((.(((((...((((((((.....(((((..((((((((.(((((.((((((((........))))).)))..)))))...)))))))).((((((........)))))).......(((((((.......(((((((((.(((((.....))))).....((((....((....((((.....))))..))...))))......(((((......((.....))......))))))))))))))......)))))))(((((((((.((.(((.....((((((((((((..(((((((((((..(((((...((((....))))............((.(((((((.((((((.((((.((((((((((((((((((((..(((((........))))).....((((((((..(((((.(((((...((.(((((((......)))))))....(..((..((((............))))..))..)....))....))))).)))))))))))))(.(((((((..((((((.((((....((((....)))).....)))))))))).......(((..((((((((((((.(((((((((((((((.....(((((((((((....(((((.(((..((((........)))).....)))..)))))...((((..((....))..))))(((((((.....))))))).........)))))))))))...)))))).....))).)))))).....((((((....))))))((((.((((....))))))))......)))))))))))))))((((......))))))))))).).)))))).))))))))))..((....))((((((((..((((((..(((((.((((.....((((((((....((.(((...))).))....))))))))))).).)).))).))))))...((((((.....(((((((....(((((((((.........(((.(((((((((((.........((((((..........))))))........))).)))))))))))..((.(((((((...((((((((.(((....)))..))))..))))...))))))).)).......))))))))).)))))))))))))...(((((((.......)))))))..))))))))...)))))))).))))))))))))).)).((((.........)))))))))........))))))))))).....(((....))).))))))))......))))..)))))))))))))).......)))))((..((((((.((((((((................)))).)))).)))))))).((((.((.(((....))))).))))..))))))))..))))))))))))...)).)).))))......)).)))).))))).....)))))).))))))).)))))))....)))))))).)))))))....)))))))))))).))))))))).........(((((..(((((((((.(((((((.....((((((((((((.((((.(((((.((((((((((((((...........)))).)))..))))).)).)))))...(((((((((((........(((((.(((((((((((((((((((......(((((....((((((((...(((.((....(((((((((..((.(((((((.((((((...(((.(((........................))).)))..)))))).))))).)).)))))))))))))..))).)))))....)))...))))).....)).))))))).))))))..((((...(((...))).))))(((((((((((..(((..(((...(((......)))...)))..)))..))...)))))))))..((((.((((((((((((..((((((..((((((.....))))))((((.......)))).....(((.(((...))))))(((((...........)))))..))))))))))).)))(((...))))))).))))...((((((((......))))))))...(((((..(((((.......)))))..))))))))).)))))))))))))))))))).))))))))...))))..(((((.......)))))...(((.((((.(((...))).)))))))........((((((.((((...((((((((.................))))))))))))))))))(((.((((((((..((......(((.((..((.......((((((((((.((.(((((((((....))))))((((....)))).)))..)).)))))))))).......)).)).))).....))..)))))))).)))...)))))).).)))((((.....)))).))))))....))))).....)).))))))))(((((..((.((((((((((((.(((((((..(((.....(((((.((((.((((((...(((((..(((((((....))))))).(((((.(((((((((((.(((.....))).)).....((((((.(((((....(((((.(.((.........(((.(((..((((((.((((((...(((.(((((..(((...(((.(((((((.((((....(((((((.((..((((((((.(((((((((.....((.(..(((((..((.........)).)))))..).)).(((((.....(((...))).....))))).((((.......))))..((((((((....)))))))).)))))))))...))))))))..)).)...((((..((((((((((((....(((((...(((((((((((((((....))))).....)))))....((....)).........)))))..)))))....))))))).)))..))..)))).....((((((.....))))))))))))...))))(((((.(((((...))))).....((((((((..((...((((((((..(((((((..((((((.(((.(((((((..(((.((.((......))..)).)))...)))).))).)))...))))))(((((((((((((((....)).)..))))))).)))))(((.(((....))).))).......)))))))..))).)))))...))...)))))))).......))))).(((.((((.(((.....((((..((((((((.........(((((((((((.....))).....)))))))).......))))))))..)))).....((((...))))((((((((.(((((((...........))))))))))))))).((((((..(((...)))..)))))).......((((((.((....)).))))))......))).)))).)))...(((.......)))..(((((((((((((((((......)))))).)))..))))....((((((((.........))).)))))....((((((((((((((((((..............)))))..)))))))))))))...))))))))))).))).)))))))))))))))))....))))))....))).((..((((...((((((...(((((.(((((..((.(((..(((((.....)).)))..........)))))..)).))).)))))..)))))).))))..))........)))........)).).)))))....))))).)))))).(((((((((((.((((((((((((......)))))))))))))))))))))))(((.((((((....)))))).)))......((((((((.(((((....(((.((((.((((....((((....))))...))))..))))..))))))))....))))))))......(((((.(((((((..(((....))).))))...(((((......))))).....(((((((.(((((.(((((.....)))))((((.(((((((((.....(((((((((.((((((((((...))))...))))))...((((((....))))))((((..(((((..(((.(((.(((.((((((((........................)))))).)).).)).))).))))))))..)))).......((((((.........(((((.(((((........(((((.....))))))))))))))))))))).((((((..........)))))).......)))).))))).((((((((((((.....((((........((((..(((((..(((((((((...........)))))))))..)))))..))))((..((((((....))))))..))(.(((..(((.(((((...)))))...)))..))).)))))..))))).....)))))))...)))).))))).))))(((((((((((.((((.(((((......))))))))))))))))))))((((((((((.(((........((((....)))).......)))))))))).)))))))).)))))))(((((((..((((((((......................(((.....(((.((((....(((.((....)).)))...........)))).)))......))).))))).)))...)))))))..((((...((((((.((((((...((........))....))))))))))))))))..))).))))).))))))))).)))))........(((((..............(((....))).((..(((((((...)))))))..)))))))...)))))...)))).)).))))...)))))..)))((((......)))).(((((((.((((((((.(((((......))))).(((((((((((((.((.(((...((((..((((((...((((....)))).))))))...))))..............(((.(((((......)))))..)))...(((((...((((.(((...((....((((......))))....))...))))))))))))))).)).))))................)))))))))((((((.(((((......)))))..)))))).((((.(((((...........((((((....))))))))))).))))....((((....))))...........((((((((((((((.((((.(....)))))......................))))))))).))))))))))).))))))))).)))))))...)))))...)))))))))..))))).....((((((...(((((..(((((((.((((....)).)))))))))))))).)))))).((((((((.................................((..((((((((...))))))))..))((((.....(((((((((((((.........))))..((((...(((......)))........(((.....)))(((((.(((....(((((((..((((.......(((((......))))))))).)))))))..))).)))))................((....)).......)))).)))))))))......))))..........((....))((((..........))))....((((((....((((((((((..(......)..))))))))))....))))))..........................................)))).)))).......((..((((.((((.(((....))).)))).))))..))))))))).......))))))(((((((((.((((..((((((.((((((..(((((((...((((((((((((..(((((................(((.(((((((((((..(((((((((((.(((...(((((((((.....)))))))))..)))))))..)))))))........(((....((.(((.((((.(((.((.(((((((((((((((((.((.((((((.........)))).)).)).))))).....))))))))..............)))).))))).))))))).))....)))...((((((((......(((.((((.....)))).)))..))))))))..........((((((((((....)))))))))).((((((..((.((((((((....)))))))).))..)))))).((((....)))).....))))))))).))..)))...(..(((((((........((((((((.........)))))))))))))))..))))))))))))))))))...))))..)))..))))))........)))))).)))).....)))))))))......((((....)))).(((((((((........))))))))).....
Thermodynamic Ensemble Prediction
...............(((((((.((((((((....))))))))...(((((.((.(,(((((((((((((((((((((((((((...(((...,,{((((((({(({,((((((({{...........((((((((((((..{((((((,{{....,......))))}}}}),}}}}}.......)))))))))))).(((((......))))).........(((((.((.((((((.....(((((.((((.((..(((((((((((((({{(((({.|,{(((((({|,,{,,{{{,,.{(((((((.{(((((((((((((.......,}}))).)))|||}|}},,,}}}}}})},((((((........)))))).....,.{{{(((({,..,{,({,{{{,{{,{{|||.....))))}....|||||,,},||||{|(({(,....,}}|{||||,,}}}},...||{|||||.|||{,,...{||,....}}),.,}},))))}))|,,||||||,.,|(((((((({{((.{{,......(((((,,,,,.}}|||{{{{{{|({,{{{{{.,,{.{{,,{{||||{,,....}))),||.|((((((.((((((.((((.((((((((((((((((((((..{{{{{.{,...,,}}},}.....((((((((..(((((.(((((.,.({.(((((((......)))))))....|..{{..((((..,.........))))..))..}....))....))))).))))))))))))){.(((((({,,{(((((.((((.{{.{(((,...))))..,,.)))})))))}.....,,{{{,.((((((((((((.((((((((((((((,...,.(((((((((((.,,.(((((.(((..((((........)))).....)))..}))))..,((((..((....))..)))){((((((|...,))))))).........)))))))))))...))))))},...})).))))))....,{(((({....)))))}{(((.((((....)))))))}......))))))))))))})|{{{(......))},))))))).}.)))))).))))))))))..{{....}}((((((((..((((((..{{{((.((((.....((((((((....{{.(((...))),)}....))))))))))).).)).})).))))))...{{{{{{,{{..,|||(({,,,.(((((((((.........{{,{(((((((({{(,.....},.,,,{{{...,....,,,,||,,..},.,,.})).)))))))))))..((.(((((((...(((({(((.(((....})}..))))..))))...))))))).)).......))))))))).}))))}})))))}...(((((((.......)))))))..))))))))...)))))))).))))))))))))||}},{|||......,..)})),)))),},,,...)))),}}}}}},,,,.|||}}}}))).}}}))))),{|||,||,},,))})))))))))))......}})}))||,.((((((.((((((((.....{....,.....)))),}))).)))))),,.((({.((.(({....})))).})))..))))))))}.})))))))))))...}),)}}}})),,....)).)))).})))).....}))))).))})))).}))))))....}))}}}))}})}})))}|,.))))))))))}|{(.((((((((,..........,,,.))))))))|}((((((((....,,..{{{{.,((((((.(((((((((.((((((((((,{({((,.....||||||||,,|||||{{(((,,,,.(((((((((...))))))))},,|||},||.(((((((((((((,,,{{...(((((.{..({((((((...(({.{{..,.{((((((((..{{.(((((((.((((({..,(((.(((,.,.........,{.....,....))).))).,)))))).))))).)).}})))))))))}}..}}}.)))))}...})}.,.)))))....,)),))))))))))))))...{{({(,({({,,,,,,{{|,(((((((({,({,((({{({,...(({||,,..|||||,,,,||}}}.,||,,,,}}}},,,...((((.((((((((((((..((((((..((((((.....))))))((((.......)))).....({.{(({...))))}}(((((...........)))))..))))))))))).))),{,...}),)))).))))...((((((((......))))))))..,(((((..(((((.......)))))..)))))||||.|||||{{{{{{{{||,,,||.||||||||...|}}}..,{{||,,,,,,,)))}},}}|{{,{{((.{{{...))),))))))).,.,,||||{({({,{(({{.,{{,{{{{{,{,|.|||.....,,.,})))},,,|||||||}},,{{,((((((((,,{{......{{{,{{..{|.......((((((((((.{{.(((((((((....))))))((((....)))).)))..}}.))))))))))........,.,}.}}),....})..)))))))).}}}..})))}}|,|{|||{|{{,,{{{((((({.,,,,..,{|||||{{{,..||||.,|,|||{{|{,|{{|{{||||{{||({|{,(((({.{((((..({(,,(((((((((({(((,..,,,.,,,(((((((....))))))).{(((|.,,((((((({,{(((.,..{|||{||..,...,||||}||))|..},{{({({(.,...,,.....|,..,||},||||||}|}}},,.}}}|({((((({{(((...((({(((((({{{{{({..(((({{(({((..((((((((.(((((((((.....({.,..(((((..((.,.......}}.}}}}),.,.||.,,{{{..,,.|{|,,.})}.,,,,)}),,.||||.......}))}..((((((((....)))))))).)))))))))...})))))))..)).)))}((((..((((((((((((....(((((...(((((((((((((((....))))).....))))),...((....}}|........)))))..)))))....))))))).|}}..}}..}}}},....,|||||.....}}}|||{{((({.....{(((,,...{||({{({{{({,..(((..(((,((((,,.,}}},))).})),,}}}|,,|}||.{{{{{|{{{{{{{.,{{({{{,{|..{{((.,{({(({{{(((((((,,,((({.{(({(({({((((((((({(((((...,||,,,,||}}}},{||||{{,,{(.{,((({(,(({{{..||,.}})),}),}}}.}}}}},,|||.|||||||,....,,,.,{(((...(((.((((.(((.....{(((..(((((({{,|,..,,..{(((((({{{{,....))}.....))))))))....,.}))))))))..)))}.....{{({...))))((((((((.(((((((,..........))))))))))))))).((((((..(((...)))..)))))).......((((((,((...,)).))))))......))).)))).}))...)))))))),.)))),||}}}}}|{|||(((((......)))))),),)..)))),,}}||{{||||}}},...{,|,}..,)))....((((((((((((((((((..............)))))..))))))))))))).,|||||.,|,||{{{||.||,|||||||,,,||||....,|||,|{{{{|||.{{..((((.,,((((((...(((((.(((((..{,,{({..(((((.....)).)))..........}))))..)).))).)))))..)))))),))))..))......,,||.......}}))})}))|||{{,.|||||{||}|{((((((((((((((((((((((((((......)))))))))))))))))))))))))}}{(({((....,}}}}}.,,,,,.,..{{{{{(((,{{{{{,|,,|,,.{(((.{{{{....((((....))))...}}}}..))))..)}}|||..,,,,||}}}}}}......(((((.(((,,,,..(((....))).,}|}...(((((......))))).....{((((((.(((((.(((((.....)))))((((.(((((((({.....(((((((((.(((((({(({...}})}...))))))..,((((((....))))))|(((....|||.{((((.({....}}.)))).}((((((...((((.(({........))).))))...)))))),{((.((((((((..{(((((({..((.,,,....}),,))}},,|)))}...}))))))).))}}}}}}})},||{,,||(((((.(((({({....,,.})))))))),.,)}).)))).))))).((((((((((((.....((((........((((..(((((..(((((((((.,.......,.)))))))))..)))))..)))){{.{((((({....)))))),.)}{.(((..(((.(((((...)))))...)))..))).}))))..))))}....,)))))))...)))).))))).)))){((((((((((.((((.(((((......)))))))))))))))))))}(((((((({{{(((....,...{{{,....}}})..,....)))))))))).)))))))).))))))}(((((((..((((((((,,..............}}....,{{.....(((.((((....(({.{,....,}.}}}...........)))).)))......}}}.)))))},))...))))))),.(((({,,({((((.((((((...{{........}}....))))))))))))))))..))).))))).,,|,}},}}}))))}..,}},},|||||.,,....||}....,{{....}})}||,,|||||||,,,,))}})},,))))))).},,.,))})}))})})).,}}}..}))))}....|({{{..}}..,))),}}|||,|}|||,})))))))||..,,,})))))}}}}}}}))))))))))}|,....((((..((((((...((((....)))).))))))...))))...,}}}.}}))}))))),,,,,.}})..))))).......,(((({..{((((.(((...((....((((......))))....))...)))))))))))))||||((((({,{{,..,,,.,,}}}}))||||||..,((((.(((({.....,}}}}}.,|||||{((((({(,((,{{{.{{{{...((((({....}))))),|,..{((((((.,.{(((({.((((,,(.{{{,{...,|}))}}})}}..}}}})),....)))))))...,,...............,}}},)))).))))).))}}})))))|,,||,},||||}...{((((((((|(,.,((((({.|((((({.,,((((,{,(((((..(((((((.((((....)).)))))))))))))).}|||}|.,,||||||.................................{{,,((((((((...))))))))..}}(({{.....((((((((({{{{.........}}})..((((...(((......,,,........{((.....))|(((((.(((....(((((((..{{{(,,,....{((({......))))))))).)))))))..))).)))))}...............((....)).......)))).))))))))).,,...}}}}...,.|||.||||..||,((((.{{....,}.)))),,..{(((((....((((((((((..(......)..))))))))))....)))))}.........,,},,.||,......|||....,,}........))))})))),},,...,{..((((.((((.(({....))).)))).))))..}}....,},.}))))...))))))}}))))).,.)),,)))))))),.|,}))},.}}}}.}.|||||||||,,,.}|||||..,}},.....}},..|||||||,......,..(((((((((((.(((...(((((((((.....)))))))))..))))))),.}))))))......|,|||,},.,|}||,.||||.{{,.{|,|||||||||{|{{(((({((,({{{||...,,,,,,)))}))),)),))))),,,}})))))))}.|,,....,}}},.}}}}.))}}},))})}}}}},..,.,}}}},{(((((((..,,..(((.((((.....)))).)))}})))))))}.{({((,,..((((((((((....)))))))))).|,,,}}}}|{.((((((((....)))))))),))..)))))))))}..{((((....))))).....,,.))))))))).)))))).{,....,,,,.((((((((.........)))))))),,,}},}|||||}},..,,,))))),...))))))))......,)))))))))},).)))))).)).....)))))......))))))).{{{{((((((.,{({,,....,},..)))))))))}....

Transcripts

ID Sequence Length GC content
AGAAUGAUGAAAACCGAGGUUGGAAAAGGUUGUGAAACCUUUUAACUCU… 6934 nt 0.4442
Summary

The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt export pump in man. Mutations in this gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that alcohol significantly up-regulated the ABCB11 expression in alcoholic liver disease, and intervention with Gentiana dahurica Fisch ethanol extract further up-regulated its expression [Cao et al. DOI:10.1016/J.Jep.2020.113422].