Basic Information

Symbol
ELOVL2
RNA class
mRNA
Alias
ELOVL Fatty Acid Elongase 2 Ssc2 Elongation Of Very Long Chain Fatty Acids (FEN1/Elo2, SUR4/Elo3, Yeast)-Like 2 Elongation Of Very Long Chain Fatty Acids Protein 2 Very Long Chain 3-Ketoacyl-CoA Synthase 2 Very Long Chain 3-Oxoacyl-CoA Synthase 2 Very Long Chain Fatty Acid Elongase 2 3-Keto Acyl-CoA Synthase ELOVL2 ELOVL FA Elongase 2 EC 2.3.1.199 ELG3 SSC2
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Other applications

MANE select

Transcript ID
NM_017770.4
Sequence length
3988.0 nt
GC content
0.3952

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-995.20 kcal/mol
Thermodynamic ensemble
Free energy: -1076.82 kcal/mol
Frequency: 0.0000
Diversity: 1057.27
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((((.((((.((((.((...(((......)))...)).)))).))))..((((((((.(((..(((.((((((.((((((((((..(((((......))))).))))))..(..(((.....)))..)(((.(((((...(((((((.(((((((...(((.(((.(((...((((....((((((((....(((((((((..............((.(((.((((.((((((((((((..((((.(((((((......))))))).......((.(((..((((((.....(((((.((((((((......)).)).))))(((.(((((.......))))).)))............)))))))))))..))).))((.((((((((((.(((..(((...((...((((((((((((((........((((..((....)).....))))...(((((..((((((((.......))))))))..))))).........((((........)))).....((((...)))).((((((((.((..(((((((..((((.((((((.((((.(((..((......))..)))...)))).))))))...........(((......)))...((((((((((((((.((((....))))....)))))))..........))))))).......))))))))))).)).)))))))).)).))))).)))))))...))....)))))))))))))))).))...))))..)))))..........)))))))...)))).))).))..............)))))...))))....)))))))).....))))...((((.((((((..(.(.((((((((.((((((((((...((((((...))))))..))))..((((((((((((((((((((((..(((((.............((((................))))........(((((((.(((((((((((((..((((........))))...))))))))))))).))))))))))))..))))...........(((((((((((((((((((((.(((....((..((((((((.......((((((......))))))(((((((...))))))).((((((.......((((((.((.(((..(((.............)))..))).))..)))))).....)))))).....((.......))..(((.((((........(((((.(((.(((.....))).)))))))).........)))).))).))))))))..)).......))).))))))).)))))))).......))))))(((.((((....)))))))....((((....)))).)))))))))))))))......)))......((((.............))))............((((......))))......)))))).)))))))).)...)..)))))).))))))).))).)))))))))))))))))..))))).)))............((((((((((((...)))))))))))).((((....)))).....(((....))))))))))))).)))))).))))))))........)))))))))))(((((..((.....((((((((((.(((((((((.(((((..(((((((((.....(((((((..(((((........)))))..))....)))))(((....((((((((((((((((((((..(((((..((((((..((((((((((...((.((...(((((((....((.......))...)))))))(((((((...((((..((((...((((((..(((((((((.((((((........))).....))))))))......))))...))))))....))))))))..)))))))...........)))).)))))))))).)))))).(((.((((...))))))).(((((.(((((..((....))..)))))........(((((...)))))..))))).)))))))))...))))))).....(((..((((....)))).)))......)))))))))...)))..((((((((....(((((((.....(((((((((((.....................(((....)))......((((....))))............((((.(((((.......................)))))))))(((((((...)))))))...........(((((((....)))))))......))))))).)))).....................)))))))...................))))))))((((((((((((....(((((...(((((((..(((..(((((((..(((((((.(((........))).))))....((((((((.......(((...(((((.((....))...))))))))......)))))))))))..)))))))........((((((((((((((((((.((............)))))))).((((........))))...(((((......((((((.(((((((.......................(((.....)))(((......))).))))).)).))).)))......)))))))))))))))))((((.(((.((.((((..((..(((....................)))..))...)))))).))).)))).(((.(((.(((((......))).))..)))))).))))))))))....)))))((((((((....))))))))............((((((((((.............(((....((((.......((((.(.((..((((......))))..)).)))))))))....))).))))))))))......((((.(.(((((((....))))))).))))).(((....)))))))))))))))...)))))))........))..))))))))))))))((.((..((((.(((.....((((((.(((((......))))).))))))....))))))).)).))......(((((((((.....((((((((((.......(((((....((((((((...(((((((((...(((((((....((((........))))))))))).))))..........(((((((..........)))))))...........((((((((...((((((..............(((((..........)))))..))))))..)))))))).................((((...(((((((((((((..........)))))))).)))))...))))((((((......))))))))))).))))))))..((((((..........)))))).............)))))((((((((((((((........((((((............(((...(((((((((((((((((((((........(((((..(((((((........................))).))))))))).(((((.........)))))(((.(((((((((((......))))))....))))))))..(((((....)))))...((((......))))..............))))))).))))......)))).))))))...)))............)))))).((((......))))...)))))))).))))))......))))))))))....))))).....)))).....))))))))))...)).)))))((((.....))))........((((((((((......))))))))))(((.((((...............)))).))).
Thermodynamic Ensemble Prediction
{(((((((((((.((((.((((.((...(((......)))...)).)))).)))).,((((((((.(((.,(((.((((((.((((((((((..(((((......))))).)))))}.,({{({,..,}}))}|,||{({((,,,}}}|,{{{{({((((((({,.,{{,|||,|,,.,,}}}}.....{{{{{(({{.{{{{,,{({{{{((.{({..{{{{{{{(||....},}}))))),,}|}.}}||.,{{{((((((((((((((({........(((((((,{(((((({.......,.{{((({(({....,)),||.||||,,,.,{{{{,,,....)))}}||||{{,,,..,....,||||.{{{{{...,{.{,((.((((((((((.(((..(((...((...(((((((((((({(,,,,,,.....,,,,.}}}||{({,,.,{{{{,{,.,,,..{(((((((.......)))))))),,||{,.,,.......{({(........}))).....,,{{...,}}},|||{{{||}||},,|||||(,,{{{{.((((((.((((.{{{..((......))..))}.,.})}}.)))))|.......,,..{((......)))...,(((((((((((((.{(((....)))}....))))))),.........))))))|....|,{||||}|||,}}.)),)))))}),.)}.))))).)))))))...))....)))))))))))))))).)),),)}...,}))},,,}.,,,....,}||||{..,,})}}},,,,{{{{{.....{{{{{.|{|...,....,.}),)))))......))))}}))))))))))),))).)))).))))))))}(((((((...((((({...})))))..))))))){,{((((((((((((((((((..(((((...........,,,{{,.........,,.....,,,,.||,....,{(((((.(((((((((((((..((((........))))...))))))))))))).))))))})))))..)))),,........,(((((((((((((((((((((.(((.,,.{{..((((((((.......((((((......))))))(((((((...))))))).((((((..,,,..((((((.((.(((..(((.............)))..))).))..))))))...},)))))).....{{.......}}..{((.((((........(((((.(({.{(({,...}))})))))))).........)))).))).))))))))..}}..,....))).))))))),}))))))).......)))))){{,.{{,,....,}},,}|,...{{{{....)))}.})))))))))))))).,....|,.......((((.............)))).......|{{||{{|,{({,...,,},.......}}}}|}}})))}..,..,||||||}},.,..,))),))}.|,,||||,||||||,},...,,))}),)}..}}}}..}|.((((((((((((...)))))))))))).,|||,,|}}|}|,....{((....))})))))))))).)))))).))))))))...,,...)))))))))},,{|{{.,({,,,,.{{{{({{{{(.(((((((((.(((((..(((((((((.....(((((((,.(((((........))))),,)}....})))){{(.,..(((((((({(((((((,(.{,.(((({..{|||||..{{{{({{{{{.....{((,{.(((((((....((.......))...)))))))..}}.))}{{((({{(,,.{({,..{((((,{,{,....,,,,.,,,....,.},},)))}|,||||,,,}}}}||.}|((,,{{|||,.|,.....,,))))))}.,}}|.{{{{,...}}|||,,|||||}}}||,||||}}.(({{((({...})))))).(((((.(((((,.((....}).,)))))........(((({...}))))..})))}.}}}}},}}...,}||}}}}{{...(((..((((....)))).))).,.}}.,})))))))...))}..{{{{({({....{{{{{{{.....(((((((((({,,.........,.....,,,.{{,.,..}}}......((((....}}}}{{{{{{{||,||{(((.((({({{{{,...,}}}},.,.......}}}))))))(((((({...)))))))...........(((((((....)))))))......))))))).)))),.,,........,,}......|||||||{|{,,........,,....}}}}}}}}|{|{{{{|||||,,,}|||{{...|||||,,,,{||..|,||{||||(,(((((,(((........}}}.,,},....{{,,,{{{,,.....||||,.{{{,,.,{,{{{|{,{{((((({.{{{....))).)))))))),.))}|||(((((...((((((((((((((((({,((............)))))))).((((........))))...(((((......((((((.(((((((........,,,,,......,}|||........}}{((......))).))))).)).))).)))......)))))))))))))))))..))))))))},}||,}}}.},}}}})),..,,..,,}}}}}},||||||.,({{{.|||{....,))}..(((.(((.(((((......)))},)..)))))).))))}})))),,,.)||||((((((((....))))))))....,,,,....((((((((((.......{{{{..({(,{{.,{{{.......{{((,(.,{,.{{,{...,,,))))..,),)),)}})))}...,,,.))))))))))..,...((({{(.(((((((....))))))).))))).(({....})}}))))))))))),..))))))),.......,)..)))))))))))))|{{(.....}})}|||,....{(((((.(((((......))))).)))))}{((((((((..{(((((({.,...,{,,,,.,,}}}.)))))))}.{{{......}))......))))))))}|((((((((({{.(((((((....((((....,}}.}..,))))))).||}|..,,,,,{,,(((((((..........)))))))...........,(((({{,...{{||||..............(((((,{,....}}.)))))..}}))))}}))}}}}}}.................{(((...(((((((((((((..........))))))))},))))...)))},{{{{{......,}}||||||.,..}))))}}..,,|{{{,.,|.,,,..))))}},..,,{,........,,,{{((((((((((({........((((((,,...,,,....(((.,.(((((((((((((((((((((.,,....,,,{({..{(({,.({{,{{...................,,,.))}}}}},..(((((.........)))))(((.{({((((((((......)))))},..,})))})))..(((((....)))))||||{((....,,)}}}.}}}}.,....,,.))))))).))))......))))}}}))))...}}}....,,.,..,.)))))).((((......)))}...}))))))).))))))}||||..,,}}}}||..,,,...,.,,,,.,,,,,,}}))))))))))),,.)},))))}((((.....))))...,....{(((((((((......))))))))))|||.{{{{.||..,..,,..,..}}}}.,,..

Transcripts

ID Sequence Length GC content
GGGCAGAGGGACCCGGCUACCCUGGACAGCGCAUCGCCGCCCGCCCGGG… 3988 nt 0.3952
Summary

Enables fatty acid elongase activity. Involved in fatty acid elongation, polyunsaturated fatty acid and very long-chain fatty acid biosynthetic process. Located in endoplasmic reticulum. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in humans demonstrated that the ELOVL2 locus (cg21572722) exhibited increased DNA methylation with age, showing a statistically significant but low correlation (r=0.234) in a Turkish population blood sample cohort, and was utilized in a validated 6-CpG age estimation model achieving a mean absolute error of 4.07 years [Gonul Filoglu et al. DOI:10.1111/1556-4029.15478]. Another human study, analyzing RNA expression during a one-year spaceflight, found that the ELOVL2 gene showed an increase in the polyA+ RNA fraction in white blood cells, with gene set enrichment analysis indicating a dynamic, cell-type-specific response in fatty acid metabolic pathways during spaceflight [Schmidt et al. DOI:10.1159/000506769].