| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGUCUGAGUGCAGAGCUGCUGUCAUGGCGGCCGCUCUGUGGGGCUUCUU… | 1069 nt | 0.4537 |
Contributes to membrane insertase activity. Involved in protein insertion into ER membrane by stop-transfer membrane-anchor sequence and tail-anchored membrane protein insertion into ER membrane. Located in endoplasmic reticulum membrane. Part of EMC complex. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans using RNA-seq data from 16 normal tissues identified the EMC7 as a housekeeping gene with highly uniform and strong expression across tissues, proposing it for calibration in biotechnological applications due to its exceptionally constant expression level [Eisenberg and Levanon DOI:10.1016/j.tig.2013.05.010].