| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUAUCUGUGGGUACCCGGAGCACGGAGAUCUCGCCGGCUUUACGUUCA… | 3161 nt | 0.5302 | |
| AGUAUCUGUGGGUACCCGGAGCACGGAGAUCUCGCCGGCUUUACGUUCA… | 1781 nt | 0.5452 | |
| AGUAUCUGUGGGUACCCGGAGCACGGAGAUCUCGCCGGCUUUACGUUCA… | 1781 nt | 0.5441 |
This gene encodes alpha-enolase, one of three enolase isoenzymes found in mammals. Each isoenzyme is a homodimer composed of 2 alpha, 2 gamma, or 2 beta subunits, and functions as a glycolytic enzyme. Alpha-enolase in addition, functions as a structural lens protein (tau-crystallin) in the monomeric form. Alternative splicing of this gene results in a shorter isoform that has been shown to bind to the c-myc promoter and function as a tumor suppressor. Several pseudogenes have been identified, including one on the long arm of chromosome 1. Alpha-enolase has also been identified as an autoantigen in Hashimoto encephalopathy. [provided by RefSeq, Jan 2011]
A study in humans analyzing peripheral blood transcriptomes from burn patients identified the ENO1 as a key lactylation-related molecule with an AUC of 0.919 for distinguishing burn patients from controls [Li et al. DOI:10.3389/fmed.2025.1554791]. Another study in humans and mice identified the ENO1 as a top hub gene for CD38high monocytes, which are a diagnostic biomarker for sepsis, and found it to be part of a hyperactivated glycolysis signature in this pathogenic monocyte subset [Hua et al. DOI:10.1002/advs.202500457]. A study in mice demonstrated that the ENO1 gene (ENO1) was differentially expressed in blood leukocytes at 2 hours post-injury, showing a model-specific pattern where it was downregulated in burn injury but upregulated in both LPS infusion and trauma/hemorrhage models [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005]. In a separate investigation in rats, the ENO1 (Eno1) was identified as a downregulated metabolism gene involved in glycolysis in liver tissue on day 1 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].