Basic Information

Symbol
EPAS1
RNA class
mRNA
Alias
Endothelial PAS Domain Protein 1 BHLHe73 PASD2 HIF2A MOP2 HLF Endothelial PAS Domain-Containing Protein 1 Class E Basic Helix-Loop-Helix Protein 73 Basic-Helix-Loop-Helix-PAS Protein MOP2 PAS Domain-Containing Protein 2 HIF-1-Alpha-Like Factor Member Of PAS Protein 2 HIF-2-Alpha HIF2-Alpha EPAS-1 Hypoxia-Inducible Factor 2 Alpha Hypoxia-Inducible Factor 2-Alpha HIF-1 Alpha-Like Factor HIF-1alpha-Like Factor BHLHE73 ECYT4
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_001430.5
Sequence length
5155.0 nt
GC content
0.5259

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1767.70 kcal/mol
Thermodynamic ensemble
Free energy: -1863.90 kcal/mol
Frequency: 0.0000
Diversity: 1352.94
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...........((((((........)))))).(((((((((.((..((((..(((((...(((((..(((((((((.((.((((.......)))))).)))))))))..)))))(((((....(..((((((((..(((......(((((((.((((((((((((((((......(((......))).(((((((.......)))))))(((((((((((((....((((..........((((..((.....)).))))..........))))((((((....(((((((((((((........................((....))........((((.(((((...(........)...))))).))))...)))))))))))))..(((((...............)))))..)))))).((((..(.((((....))))..)..)))).)))))))))))))(((((((((....))))).....))))..((((..........))))....)))))))))))))))).))))))))))..))))))))..)..))))).))))).)))).)))))))).)))((((..(((((((((((.(((........))))))).)))))))(((((...(((((((....((((((((..((((((((((.(((...(((...((((((((..((..........((((......((((......))))....)))).....)).))))))))))))))))))))..((((((((((((...((((((.(((((((((....)))).)))))..((((..((((.((....))))))......)))).((((((((.((((((((...(((((((.(((....((((((.(..((((((.(((......((((......((((((....))))))((((((.(((((........))))).))))))))))....))))))))))))))))....)))..((((......(((((.((((((..((((((.........))))))))).))).)))))))))..)))))))(((((((((((...((((((((...((((......................))))....))))))))((((......))))..(((((...((..(((.(((...))))))..))...))))).((((.....))))..((((....)))).)))))))))))((((((.((((((((.(((((.....)))))....(((((((......)))))))..((.(..(((....))).).))..))))..)))).))))))..............((((..((........))..)))).....))))).)))))))))))...)))))).))))))).))))))))).)).))))))))))))).....))))).((((((((.(((((.(((((((((((.(((........))).))...((((.((((((((..(((((((((...((..((..((((.....).)))..))..))...)))))))))......)))......((((.((((((((((.(((.........)))..))))))((.(((((..((((.((((..((((((.....(((....)))....))))))..))))...))))..))))).))....(((((((((...)))))))))....((((((((........)))).)))).....)))).))))......((((...)))).((((.((((..(((((((((..((((..(((.(((.((((.(((((...(((((.((..((((.(((((.......))))).).)))...)))))))))))).))))))).((((((...)))))).((((((((.((.((((.(((((((((....))))))........((((((..((((((.........((((((((........))))))))((((((((((.......((((.(((.((....))..))).)))).....(((((....((((((((.......(((((((...(((.(((...(((........(((....))).((((..(((((((.((((((((.(.(((......))).).))))..)))))))........))))..))))...((((((...)))))).............(((((((.((.(((...(((.(((...(((((((........((((...(((((..(((((((.(((.((....(((...((.((((((((((((((((((((((..((((......))))..))).((...))...((((.(((((((((((.((((((...(..((((((.(((.(((.((((((((........((((..((((((....(((((.((...........(((((((...)))))))...)))))))(((.......)))...(((..((((((.(((.(((((.(..(((((...((((..(((....(((((......)))))..)))..))))...)))))..).))))).)))))))))..)))))))))))))((.(((((((....((((..((....))..))))))))).....)).))..)))))))))))...))).))))))..)...)))))).))))))).((((((...))))))...((((((......((((((((((((((((((..((((.((((((........))).))))))).))...........))))).((((...((((....))))..))))))).)))))))).))))))..(((((.((((.........((....(((((.((((.((((.((....))..)))).))))...(((((.........)))))..)))))...)))))).).))))......)))).)))))))))...))))).))))))))).))..)))...))))).)))))))..)))))..))))....))))))).)))..))).))).)))))))))........((((.((..((((((...))))))))))))(((((..((((...))))..)))))...........(((((.....)))))...)))))))))))))))).......))))))))...)))))....((((..(((...(((((....((((((...))))))......))))))))..)))).(((((((......)))))))......(((...)))((((((.............))))))......................(((((........)))))(((((((((((((((..((((......((((......(((((....((((((((((((.(((((...............(((.(((..((((((.(((....))).))).)))))).)))...((((((((((((.(((..((((..(((((......)))))...(((((.(((((.............))))).)))))....((((...))))..))))...))).))))))).)))))(((((((.((((((((((((...((((..........(((((..((((......................))))...))))).......)))).)))))))))))).)))))))....((((.((.((((((......(.(((((.(((.(((..(((......)))..)))))).))))).))))))).)).))))(((((((.....(((((..........)))))....)))))))))))))))))))....)))))))))).....)))).....))))............(((((....)))))...))))).))))))))))......)))))))))).....))))))..))))))......((((((((((...))))))).)))...((.((((((((((.((((((.(((((...)))))..)))))..((.(((((((....((((((((((((......)))))))).).))).)))).))).)).........).)))))))))).))(((((((((((((((.....)))).........(((.(((.((....)).))))))...)))))...))))))..))))))).).).))))))))))))))).(((((....((((.......((((........))))....)))))))))((((.....).)))(((.((((((.(....(((.(((((((..((((((......(((((...)))))......))))))((((....))))(((((((............))))))).((((((..(((((((........)))))))...))))))(((((.(((((..((.(((((((..((......)).((((((....))))))..)))))))))..))))))))))..))))))))))..).))))))))).)))))))))....)))).))))...))))))))))))))))))..))))).))))))))...((((.(((((....)))))))))(((((.((((((.((((.(..((((((((((.......)))))(.(((((((.((((.((((((.(((....))))))))).))))...))))))).).......((((((((((.........((((..(((....)))..))))(((.........(((((...............((((....))))((((((((((.((((......))))......((((.((.((((......)))))).)))).((..(((((......)))))))))))))))))...((((......))))....))))).......)))))))))))))(((((.......)))))....)))))..).))))............((((.............)))).........((((((((((.(((.(.(((((......(((((.((.((((((.........)))))).)).)))))((((.((........)).))))..))))))))).))))))..))))......)))))).))))).)))).
Thermodynamic Ensemble Prediction
.,,{{.,..,.((((((........)))))).|((((((((.((..((((..(((({...(((((..(((((((((.{,(((((.......)))))}.)))))))))..)))))(((((....(..((((((((..(((......(((((((.(((((((((((((((({.....({{......)}}.((((((((....)})))))))(((((((((((((....{{((,.,.......((((..(,.....,,.}}}}..,,,.....})))((((((....(((((((((((((.....,..................((....))....,{|.((((.(((((...{........)...))))).)))),,.)))))))))))))....{((..........,||,.,,)))..)))))),((((..{.((((....)))).....)))).)))))))))))))(((((((((....})))).....))))..((((..........)))).,,,}))))))))))))))).))))))))))..))))))))..)..))))).})))).)))).)))))))).))}.((.(.(((((((((((.(((.,....,,}}}}})),}})))}}||||,.,}||((((({{{{(({,(((({{(,,,((((((.(((...(((...((((((((..((..........((({..,...((((......))))....))),..,..)).))))))))))))))))))))..,|||||,||(((,{.(((,,,,||{|||||{.{{{||||.},,))..,|||}}{{{{.((....}}}))).,....,})).{{{{(((({(((((((({{{(((((((.({{....((((((.(..((((((.(((......((((......((((((....})))))((((((.(((((........))))).))))))))))....))))))))))))))))..,{|||{{({{{......(((((.((((((,,{(((((.........))))))))).))).)))))}}}}.,||||}}|(((((((((((.......((((.{{{({...........,..))))))...,,,,....{{{{((({((,....,((,,..,,|((((...((..((({{{,...}}))))..))...)))),.,..,.}}}})))))}{{((....)))).)))))))))))|{((((.{(({(((({((({(,,...|||||{{{.(((((((......)))))))..{{....{{||.,.,}|....}}.||||{|||||,}}}}||{.{,{{........||||.}||.{,,,,..,}..},}}.....))))).|}}}}}||||}...}))))),))))))).},))))))),)}.}})}|||||}}},.,}}})||||{((({{{(({(((((,(({((((((({.(((........}}},||{{....{{(({{{,{.,||||,,,{{{{{{{{,|{{||{{{{{,,,||,||||.||.,|,.,|}}|||||({(((((.,{{,|{{{.,{{{,{,,(((((((.(((.,.......)))..))))))},,,,,,|},,,||.{{{|||.{||||}||||{{{|.,.||,,...|{{{{{..,,.,........}))))).,((((,(((((((((...)))))))))....{(((((((.,....,.)))).))))...})}}}..,}}}....,,((((...))}}.((({.{(((..((({{{{{{,,{{{{,,|||.(((.{(((.(((((...(((((.((..((((.(((((.......))))).)},))...)))))))))))).))))))).{{{{{{..,)))))),{{{|||||.,}|||}|,,||((((((....)))))).,..{{..,{,{|{.,{{{{{{,,{{{,,,,({((((((........}}}|||||{|{{|||{|{{|{,,|,|||||(((.((,...)}..))),}}}}.,...{{(((....{{{{{||{.......{{|||||...|||.{{|..,|||...,....|||||.}}}..((((..(((((((.((({(({{,{.{((......})).),))}},}))))))),.......})))..}))),,.((((((...))))))..,|.......,,||||||||||.|||.,.|||,|||}|.(((((((........((((.{.(((((..(((((((.(((.((.{.,(({,..{(.((((((((((((((((((((((..((((......))))..||}.{{...}}...{{{{.(({{(((((((.((((((...(..((((((.(((.(((.((((((((........((((..((((((....(((((.((....,......(((((((...))))))),,.))))))),{,.,.....}}..,.{((,.(((((,{(((.(((((.(..(((((...((((..(((....(((((......)))))..)))..))))...)))))..).))))).)))))))))..)))))))))))))((.((((((,...{((((..((....))..))))))))).....)).))..)))))))))))...))).))))))..}...)))))).))))))).{(({{,..,}|||||...((((((..,...(((((((((((({(((,,..{(((.((((((........))).)))))}}.}}.,,,...,,..,}})).((((...((((....))))..))))))).)))))))).}}}}},..((((..,}}|}...,.,}}||,.,.{((((.((((.((((.((....))..)))).))))...(((((.........)))))..))))}...|}|||,.}.}}}},.....)))).)))))))))...))))).))))))))).)),.)))..,))))).)))))))..)))))}.)))),...))))))),)))},))),)}),)))))))),.}}}}...(({,,({..((((((...)))))))})||}(((((..((((...))))..))))).,,...,,{{{(((((....,|||||{|.||}}}}}}}})})),),......||||||||,..}}}},....((({..{{{...|||{{....{{{{{....}))))),.....}}))))))..)))),||||{{{......)))))}}......(({...)))((((((..,.......,..)))))),,,.....},....,}}}}}}}|{({.{.{{{{{{{{{{{((((((((({(((((..((((......{(((......{{{{(...,((((((((({{{.{{{{{|{,.,,,,,,,....(((.(((..((((((.(((....))).))).)))})).)))...((((((((((((.(({..{{||,,.,,,,.....,|||,....{{(((.(({((.{{.......,,.))))).))))),...{{{|..,|}}}..})}},}.))).))))))).)))))(((((((.((((((((((((...{{{{..........((((,..,,(({{{{...............,,,},)),,,)))))..||...}))).)))))))))))).)))))))..,.{(((.{{.((((((,,,,,,(,({{{{,{{|,|||.)})))},,,.},,..|,}},),},.,|,.||}}}}.}),})))..,,,,,.....,{{,(,,,,,.....,}})),,,.,}}}}))))))))}}}}}}....}))))}}})},....)))).....)))),,....,,....(((((....)))))...))))).))))))))))...,}}))},,,})))})),),))))|{||{|},,|||.,{{,{{((((({|{{({,{{{{{{|....,,.((((((((((.{(((((.(((((...)))))..))))),,({.(((((((.,,.((({((((((((......))))))))})}.)).)))).))).)),,.......).)))))))))){(|{((((((((({{{,,....{{{((((...,,..}}},|||.,,....,}.}|}||{{{.}||}}.,,},)))),,)},))))})}.,)))))))),)))|}|{((((({{{,(((({....}}}|}|........,|||{{.,{,|{|||||(({(...,,|{|||(((.(({{{,.,....(((.(((((((.,{{((((......(((((...)))))......)))))}((((....))))(((((((............))))))).((((((..(((((((........)))))))...))))))(((((.(((((..((.(((((((..((......)).((((((....))))))..)))))))))..)))))))))).|))))))))))..}.}||||||||{|||}||||,....)))).,,,)}}}))}}}))))))))))))),.)))))}))}))}))}..((,(((((({....}))))))})}))))}}}},,,},.,}}..,{{{{{(((((.......))))){.(((((((.((((.((((((.(((....))))))))).))))...))))))).,.......{(((((((((..{{,,.,{((((..(((....)))..))))|{,.,,.,,,,,,,,,..............,,(({{....}}},.,}}|}}}|{{{((,.,,...,,}..}}}}))}}},|}{.((((((.{{.(((((((((((.,,.(((((......||}}},,{{||||}}..}))}},})).))))))...))))).)}.)))))).,)))))))))|(((((.......))))),...)))))})))}|||||,,...)))))))},}}}..,,...}))))).......,.))}})})},...}}}}.|.||}}}}}}}}(((((.{{.((((((.........)))))).}}.))))).,,)))))))))}.,{{{{{,,((({...(({{{,{,|.,..,,,.,}}},})))))),,.....}}}}.

Transcripts

ID Sequence Length GC content
ACACUCGCGAGCGGACCGCCACACGGGUCCGGUGCCCGCUGCGCUUCCG… 5155 nt 0.5259
Summary

This gene encodes a transcription factor involved in the induction of genes regulated by oxygen, which is induced as oxygen levels fall. The encoded protein contains a basic-helix-loop-helix domain protein dimerization domain as well as a domain found in proteins in signal transduction pathways which respond to oxygen levels. Mutations in this gene are associated with erythrocytosis familial type 4. [provided by RefSeq, Nov 2009] CIViC Summary for EPAS1 Gene

Forensic Context

A study in mice demonstrated that the EPAS1 was expressed at higher levels in monocyte-derived macrophages compared to microglia following spinal cord injury, though its expression was below the detection threshold in microglial samples [Stewart et al. DOI:10.1186/s12974-021-02161-8]. A study in mice demonstrated that the degradation of the EPAS1 mRNA, measured via qPCR in heart and brain tissues over a 0-48 hour postmortem interval, was significantly correlated with PMI [Peng et al. DOI:10.1007/S00414-019-02199-7]. In both tissues, the shorter amplicon (HIF2a-S) showed the strongest correlation, and its degradation pattern was successfully incorporated into mathematical models for PMI estimation, with comprehensive multi-marker models achieving high correlation coefficients.