Basic Information

Symbol
EPB41
RNA class
mRNA
Alias
Erythrocyte Membrane Protein Band 4.1 4.1R Elliptocytosis 1, RH-Linked Protein 4.1 Band 4.1 EPB4.1 P4.1 EL1 Erythrocyte Surface Protein Band 4.1 E41P HE
Location (GRCh38)
Forensic tag(s)
Individual identification Tissue/body fluid identification

MANE select

Transcript ID
NM_001376013.1
Sequence length
6031.0 nt
GC content
0.4712

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1911.40 kcal/mol
Thermodynamic ensemble
Free energy: -2024.31 kcal/mol
Frequency: 0.0000
Diversity: 1240.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((.((((((.((((((.(....).).))))).))))))...))))))(((....)))....(((((((((((.(((((.((.((((((((((((...)))...))))))).((.((((..(((((.((.((((((((((((((((.((......))))))))))))))...))))))))))).)))).))..)))).........(((...((((.(((((((..((((..((((((((.(((....((((..(........)..))))..)))..((.((((((((((..((((((.((((.....))))..))))))....(((...)))..((((((...((((((....((((((...(((((((....((((...)))).......)))).))).......((((((.((((((..(((((((((((((((((...((((.........)))).......(((.((((((((...((((((((((((((((((............((((((.(((((((((((((((((.((((((...(((.......((((..((......(((((.....))))).....))..))))......)))))).)))............(((.(((....))).)))((.(((....(((((.((.........)))))))...)))))(((((((((((.((((((....((((...((((.(((((.((....(((.((((((.((...............((((((((((.(((((.(((((((....(((.....(((((.(((((..................((((((......(((..((((((((..((((((((((((.........)))))...(((((.........((((.((.....(((((....))))).((.((((((((..((((((((..((.(((((((((((((((((((((((((...........)))))...))))))))))((((((.(((..........((.((.(((.((((.....(((((((((((((...)))))))))))))..))))))).)).))..........((((((((((...........))))))))))..))).))).)))....(((((..((((((((..((((((((((((..((((.((((((((.((((((.....(.((((((....)))))).).........((((.((((((((((((....(((((..(((((((..((((((..((((((....((((((((((.(((....(((((((((.(((...........))).))))))))).((((....)))).))).))))))))))........(((((((((.((((((...(((..((((((((....(((..((.((.(((.((((((((((((......))))))))))))(((((..((((((((((......)))))).))))....))))))))...)).))....))))))))))).)))....)))))))))))))))......))))))((((((.((((..(((..((((....))))....(((........)))......(((.((.(((..((((((.((((..((((((..(((...(((..(........)..)))..))))))))).....(((.....((((.....))))....))))))))))))).....))).))))).)))..))))...))))))..)))))).(((((((((((((..((((.(((....(((((.((............((((...))))..)))))))))).))))...)))))))))(((....)))((((((((......((((((.....((((((.(((.((.((((.((((...((((((((((......(((.(((.........))).))).(((....(((.........((((....))))..)))....)))..)))..)))))))..)))).)))).)).))).(((........)))...((((.......))))...((((((........)))))).)))))).........))))))(((.(((......)))))).(((((((.(((((............((.......))............))))).)))))))..(((((......))))))))))))).(((....))).)))))))))))...))))))))))((((........))))...........)))))))))))....)))))).(((....((((.((((((((....))))))...)).))))....)))...............((((......))))..((((......))))..((((((((.......)).)))))).....))))))))((((((.(((.....((((((((((.((....((((((((.(((((((..(((.(....((.((.(((....)))))))..))))..))..))))).)).)))..(((((......((((..(((((....((((............))))........)))))........))))......)))))..)))....))))))))))))....)))))))))....((...((((....(((((.(((.(((((..........)))))))))))))))))....))))))..))))))))))))....)))))..))).))))))))))))))).))..))))))))..)))).)))).))((((......(((......)))......)))))))))))))))))))))))))))))).)))...((((..((((..(((.((.....((((........))))....)).)))))))..))))...((((.....)))).)))))).))))))))))....(((((((((......)))))).)))(((((..((.((((....)))).))..)))))....(((..((...))..)))..))).....)))))))..))...)))))))))))))....((((........)))).((((((..((...(((((((.......(((((((....((((...((((((((((((.((((.((((...))))....)))).)))).)))))))))))))))))))((((((((((.(((((.(((((....((((((.(((...(((((((((.....))))).(((((((.((((((((.((..((.((.....)).))..))..)))))).)).))....)))))((((((((....)))))..)))..))))...))).))))))....))))).)))....)).))))))))))..)))))))..))..))))))..)).)))))).)))...)).))))).))))..))))..)))))).)))))))))))......((((((...((.((((((((((.........).)))))))))))..)))))).)))))))))........((((((((.....((((((((.(((((((((((.....))).(((((..((((.......)))).(((((((((((..((((((.(...(.((((((.....)).)))).)...))))))).)))).)))))))....................(((((((((.((.....)).)))))))))(((((.....))))))))))....)))))))).)).)))))).(((((((((((((((((.....)))).))))))...))))))))))))))))))))))))))))))))))))).)))..((((......)))).)))))))((((((((((((....))).).)))))))).................(((((((......(((((....))))).((((.(((..............))).).)))..(((((((((...)))))))))..))))))))))))))).)))...........((((((((((.(....).))))))))))..(((((((((.((((....)))).)))))))))))))))))))))))).......))..))))))))))))(((((((.((((((((((((((.((....)))).)))))))..))))).))..)))))....(((.(((((((((.((((((((((((((.((((((......(((.((((((......(((((((.....(((.((((...)))).))).(((...((((((.((((((..(((.....)))))))))...))))))....)))...((((....))))..)))))))......)))))).)))......))))))..)))))))...............(((.....)))..(((....((((((.(((...........((((....)))).....((..((((.(((...............)).).))))..))))).))))))....)))......))))..)))))))))))).)))........))))))....))))))......))))))...))))))))))))))))))))))))))))))).))))...)))((.(((.((((...(((...)))...)))).))).))....((((((((((.(((((.((.((.((((((((((((((((((........))))))))))))).....(..((((.((((.((((.......(((((((((((((((((((((.(((......)))))))))(((......)))((((((((((((.....(((((..((((((.........)))))))))))((((.((.((((..((((....))))..)))).))........))))(((((......)))))...((((...((((((((((((((((((((...))).)))))).........(((..(((((..(((.((((.....(((.(((......))))))....)))))))..)))))..))).)))).....)))))))...)))))))))).)))).))......(((((..(((((((.....)))))))...))))).....)))))))))))))))...)))))))).))))..)..(((((......)))))))))).)).)).))))).))).)))))))...((((((..((((((((((((((((.(((....)))......((((((((((.(((((((..((((((.(((((..........))))).))((((......))))...((((.(((.(((((.((((......))))..(((((.((((.(((....))).))))((.(((...)))))........((((..........))))....((((((((.......))))))))....(((((..........)))))(((.(((........(((..........)))........))))))(((((...))))).....(((((.(((....))).)))))))))).))))).))).))))((((((..(((((((((.....)))))).)))..))))))))))...))))))).))).)))))))...))))))))))))))))..))))))))))))).)))))))))..((((((((.((...(((.........))))).)))((((((...)))))).......((((((.((((.(((.........(((((....))))).))).)))).))))))((((((....)))))).(((......))).((.((((((((......(((((((((..(.((..((((.(((((.(((((....(((((((((..(.(((((((((((.........)))))........(((((((......)))).))))))))).)..)))).)))))))))).))))).))))..)).)..))))))))))))))))).)).)))))..
Thermodynamic Ensemble Prediction
.{{{((((((((((((((.(((.((.{(.....)).)).))).)))))))..(((....)))....(((((((((((.(((((.,,,({((((((({({...}}}.,.))))))).{|,{(((..(((((.({{((((((((((((((((,({......)}))))))))))))...))))))))))).)))).}}..}|}}.......,,,{,.,.((((.(((((((..((((..((((((({.,{{.,..((((..(........)..))))..)},..{,.((((((((((..((((((.((((.....))))..))))))....(((...)))..((((((...((((((....((((((,...||||||,...((((...)))).......,,}}.|||,......(((((((((((((,.{{{((((((,((((({,....,,,......}}}))))}|||...,{(,{,{,,,,,...(((((({(((((((((((((((((((.{({((((((({,(({{..(((((((((.((((((...(((....{{,((((..((.,,..{(((({.....))))).....))..))))})....)))))),,)),,...,......{|{.|{{.,,,||}.}||{(.{((.,,.(((((.((.........))))))).,,))))}(((((((((((.((((((....((((...((((.(((((.((....(((.((((((.((...............((((((((((,{{{,,.{(({{{(,,,,{{......(((({{(((({.................,,{|..,.,....{((..((((((((,.{(((((((((((.........)))))...(((((,,,,,,,,.((((.{{....,|{|||....,)))),||.((((((((..((((((((..((.(((((((((((((,,{{{,,,,(((,,..|,|||,||||..,,,||||||||..{{{{||.{{{..........{{.{(,|{|.((((.....(((((((((((((...)))))))))))))..)))}|)},)}.}}..........((((((((((...........)))))))))).,))}.))).))}....,,{{(,,{{{{{|||,.((((((((((((..((((.((((((((.(((({(..,{,(.((((((,,..}|||||.|.......,,{{{..{((((((({{{{|....{(((,,({{{{{,..}|||||.{((((((.,,,((((((((((.(((....(((((((({.(((.,{.....,}.))).})))))))).((((....)))).))).)))))))))).{.,({..(((((((((.((((((.,,(((..((((((({...,(((..((.((.(({.((((((((((((......)))))))))))){((((..((((((((((......)))))).))))....)))))}}),..)),)}....))))))))))).))).,,.)))))))))))))))}}},..}})))}((((((.((((..(((..((((....))))....(((........)))......(((.((.(((..((((((.((((..(((((({,(((...(({..{........)..))}..))))))))).....{{(.....((((.....))))....))})))))))))).....))).))))).)))..))))...)))))).{(((..((((((,{((((.{(((((((((,..{{{(,..((.....))}}))....)))}....,)).))))))))))))))..)))))))))}||||..,.}}}{{{{{{{{||{{,,((((((((((((((........,)}.))))||))))}}|||||{{({.{,|,,{((.(((.,.......}}},}}}.{||....,,,....},...{{{|...,|||}..,|......,,....,.,)))}}}),.|||||||},,|},,,||...,.,..}}.))),.,{{|{.......)}}}...((((((........))))))....}|||......,.|,,,,,|||,|({......))}}}}.||||{((.(({({.,,..........,.......}}.,,,,.,.....))))).}}}}}}},.{{{({......})))}}}}}}}}}.{{(....)))..,,,}}}}}},...,}})))}}})((((.,......))))..........,)}}}}}}}|}}...,)))}))..((...(((((.,,((((((....))))))..)))))..,}},,}},...,,,,........((((......))))..(({(......)))}.,|{(((,.{,|,....,)})))))},,...))))))))((((((.(((.....(((((((((,,((....{{,(((((.((((({{..(((.(....((.((.(((....))))))),.,)))..))..))))).)).))|{.(((((......((((,,(((({...,((((............))))......,}))),,........}}))......))))).,,))....))))))))))))....)))))))))....,,...{(((,...{||{{.(((,((((({..,,,,...}}}}))))}})))})}),.,,))))))..))))))))))))....)))}),,))).},))))))))))))).))..))))))))..)))),}))).},((((..,...(((......)))......)))),,}}}))))))))))))))))))))).))}...||,,..{((({{{...,{,....((((........))))....||{||.,}}}..}}}....{{{{.....}}}},)))))).))))))))))....(((((((((......)))))).)))(((((..((.((({....}))).))..)))))....(((..{{...})..)))..|||..,,.)))))))..}},,.}})))))))))))....((({,.......)))),{(((((..((...(((((((.......(((((((....((((...((((((((((((.((((.,{{,...||,,..,,)))).))))})))))))))))))))))))((((((((((.(((({.(((((....((((((.(((...(((((((((.....))))),(((((((.(((((((,.((..((.((.....)).))..))..}))))).)).))....)))))((((((((....)))))..)))..})))...))).))))))....))))).}))....)).))))))))))..)))))))..))..)))))}..)).)))))).)))...,),))))).))))..))))..)))))).))))))))))),...,.((((((.,.((.((((((((((.........),})))))))))),.)))))).))))))))){((((....((((,..{((((((.,{,((((.((((...||},..}))),{{{{,..((((.......)))).(((((((((((..((((((.,.,.,.{,((((.....)))),}}.)...,)))))).)))).))))))),,..,,.......})))))}(((((((((.((,...,)).)))))))))(((((.....)))))))))}..))))),,.})}})))))))),((((((({(((((((((.....)))).})))))...))))))),}},,,,,})),)))))))).))))})))).)))..((((......)))).})}}}}}((((((((((((....))).)))))))))),,|}||||......,||||||....,..,,(((({.,,,|||||(({{{.||,,,..{{{{(,(({.,,.|,{|{{{{,((({,,,,}}})))))),),,..)))))))),})))))))),....,}}},.((((((((((.{....}.))))))))))..(((((((((.((((....)))).))))))))),)}}}}}))))))}},))}},}),,.))))))))))))((((({(.{(((((((((((((.((....)))).)))))))..))))).}}..)))))..,{(((,(((((((({{(({((({(((((((.((((((......(((.((((((......(((((({.....{((.(({,...}}}),))}.(((...((((((.((((((..({,.....,),))))))...))))))....))).,.((((....)))).})))))))......)))))).)))......))))))..)))))))}..............{{{.....}}}..,,{,,,,((((((.(((..........,((((....)))}.,,,.((.,((((,{,,..,{{.,,,....,,}..}.))}}..},))).))))))...})))}.,..,)))),,))))))))))),.}},.....})})))))}....))))))......))))))...)))))))))),}))))))))))))))))))).)))).,})}|{{.(((.((((...(((...)))...)))).))).,}....((((((((((.(((((.((.((.((((((((((((((((((........))))))))))))).....,..{{{{.{{{{.((((,,,,...((((((((((((((((((((({(((......))))))))|(((......)))|{((((((((((.....(((((,({(((((.........))))))))))){{((,((,(({{..||{{,,.,))||,,|||}..,..}},..,))}}(((((......))))}...{(((...((((((((((((((((((((...))).)))))}.........(((..(((((..(((.((((.....(((.(((......))))))...,)))))))..)))))..))),)))).....)))))))...))))))))))},))).,,......(((((..(((((({.....)))))))...))))).....)))))))))))))))...}})))))).))))..}..(((((......)))))))))).)).)).))))).)))))))))))...((((((..((((((((((((((((.{{{,,,,}}}......{(((({{(((.(((((((..((((((.(((((.{........}}))).)){(({.....,}}}}...((((.(((.(((((.(,(({.....,))),.(((((.,,,,(((({{..|||||||.,,,{{({,.,,,.,........,{||......,,|.}}}}...,((((((((.......)))))))}},..(((((..........))))),|||((,........,...,|,.,,,..)))........))))))(((((...))))).....(((((.(((....))).)))))))))).))))).))).))))((((((..(((((((((.....)))))).)))..))))))))))...))))))).))).))))))).,.))))))))))))))))..))))))))))))),}))))))))))))}}|(((.((...(((,......,.))})).))){(((((...)))))}..,,...((((((.((((.(((..,,,.{{,{,,{|,,.,)),,,.))).)))).)))))){(((((....)))))}.{{{......}},.{{.((((((((......(((((((((..(.((..((((.(((((.(((({...,(((((((((..(.((((({(((((.........))))),......,((({(((......)))}.))))))))).)..)))).)))))))))).))))).))))..)).)..))))))))))))))))).)).....,..

Transcripts

ID Sequence Length GC content
GUCAGUGCAGGUGGAGGCCCCGGCGGGGCAAAGUGGCAGGAACCUCUUA… 5980 nt 0.4649
GUCAGUGCAGGUGGAGGCCCCGGCGGGGCAAAGUGGCAGGAACCUCUUA… 5675 nt 0.4701
Showing 21 to 22 of 22 entries
Summary

The protein encoded by this gene, together with spectrin and actin, constitute the red cell membrane cytoskeletal network. This complex plays a critical role in erythrocyte shape and deformability. Mutations in this gene are associated with type 1 elliptocytosis (EL1). Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Oct 2009]

Forensic Context

A study in humans demonstrated that whole transcriptome shotgun sequencing of low-template blood samples (equivalent to 50 pg gDNA) can identify RNA-based SNPs for forensic human identification [Jepsen et al. DOI:10.1016/j.fsigen.2024.103089]. The EPB41 (rs2249138), located in the EPB41 gene and ranked 7th in expression in whole blood, was identified as one of 24 candidate human identification SNPs, which together achieved a mean match probability of 4.5·10^-9 and showed high genotype concordance with DNA in both fresh and degraded blood stains. A study in humans demonstrated that the EPB41 is a tissue-specific RNA marker used as the target for a blood-specific quantum dot molecular beacon (QDMB) in a confirmatory test for body fluid identification, showing significant fluorescence increase with its target RNA (p < 0.0001) and no detected sexual dimorphism [Young et al. DOI:10.1111/1556-4029.13544]. Another evaluation in humans identified the EPB41 (ANK1) as a moderately expressed and specific mRNA marker for blood in singleplex and multiplex formats, performing well on casework and environmentally exposed samples [Haas et al. DOI:10.1016/j.fsigen.2010.09.006].