Basic Information

Symbol
EPHB4
RNA class
mRNA
Alias
EPH Receptor B4 Tyro11 HTK Tyrosine-Protein Kinase TYRO11 Hepatoma Transmembrane Kinase Ephrin Type-B Receptor 4 EC 2.7.10.1 MYK1 Tyrosine-Protein Kinase Receptor HTK Ephrin Receptor EphB4 EC 2.7.10 CMAVM2 LMPHM7 TYRO11 EphB4 HFASD
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_004444.5
Sequence length
4353.0 nt
GC content
0.6265

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1939.20 kcal/mol
Thermodynamic ensemble
Free energy: -2013.99 kcal/mol
Frequency: 0.0000
Diversity: 1180.09
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((((((((.((((((.((((((((((((((((((((((((((((((.(((((((((((((((((((((...((((.((((((.......(((.((....)).)))........)))))))))))).)))).(((...)))..))))))))))))))).))).((((..(((...))).))))...(((((((((....))...))))))).(((((.((............((((((((((((((.((..(((((.((((...((......))....)))))))))..)).)))))))))).))))(((((((...(((.((((....)))).)))))))))).((.(((...((((((.......))))))))))).)).)))))))))))))).....((((((((.(...((((((.(((.......(((((((....)))))))..(((((.((((((((...(((.((((.(((((((((.(((....)))))))))))).)))))))((((...(((....)))...)))).......((......((....))......)).)))))))).)))))))).))))))).))))))))(((((.((((((.((((((((...(((.(((((..((((...((((((((((((....)).)))).(((((.(..(((((((..(((.(((((((((((...)).)))..)))).))...))))))))))..).)))))))))))...))))..))))))))))))).))).))).)))))))).))))).(((((((((....(((((((.......)))))))....(((((((..(((((.((((((....)))......(((.(((.((((.((.....)).)))).)))))).....))).)))))..)).)))))...)).)))))))..)))))).))))...))).))).)...))...)).)))))).))))))).(((..(((.(((((((.....(((((....)))))....((((((..((.((((.((....(((((((((..............))))...((((((.((.(((((((..(((........)))...........(((((((((((((((((((((((((.....((.((.((((...))))))((((((((((((.((..(((......)))..))..))..)))))).))))))....))))))))))))).))))))).))))).))))))).)))))))).)))))......)).)))).))..))))))(((((.(((((...((.......)).))))))))))))))))).)))..))).......(((((((...(((..(((..(((((((((...(((((....((((....)))))))))...)))))....((((((((...)))))).)).........((((....))))((((....))))......))))..))).......)))..)))))))..((((((((((...(((((.(((((((((((......(((((((((((((.((.(.(((.(((.((((((((((.(((.....))).))))).)))..........(((((...))))).)).))).).))))).))))))))....)))))...((..((((((((..........))))))))..)).......))))..)))).))).)))))(((((.((((((((((..((((.((...((((....)))).)).))))...((((((((.(((.(((...((((.(.(.((((((((.((((.(.(((((.((((((((((((......))))))).(((....))).((((((((((.((..((((((...(((.((((.(((.(..(((((((((.(((((((.(((((.((((.....))))..))))).))...))))).))))).(((((((((.((((((((((((...)))))).(((((((((((..((((((((...))))....))))..........((.((((......)))).)))))))).(((..((((((.((((((((((((((((((.......))))))).))))(((((((((.((..(((((.(((..(((((((..((((((.((.................)).)))))).........((((........((((.(((.((((((((.((.((((((..((((......)))).(((((....)))))..........(((((((((....(((((....(((((....))))).(((.((.........)).))).((((((((((.((((....(.(((.(((((((((((........)))))............(((((.(((((.(((((.(((......((((((((.((((..((....))..)))))))...(((((..(((((.......))))).)))))..)))))........(((....)))(((((((...........)))))))))).))))).))))).)))))........))))))))).)))))...))))).)))))..).))))...)))))))))..(((.....)))(((((((.((((((...))))))))))))))))))).))))))..)))).))))))).))))..(((((.((((((.....((((((((....(((........)))(((((.....)))))((((((((((.(....(((((((....))))))).((((((.(.(((((..((((((((((......))))))......((......))((((((....))))))((((((....))))))((((......))))......)))))))))).))))))((((....))))).))))))))))).)))))))..)))))).)))))..))))))))))))))))).)))))))))))))))).)))))))))....)))))............(((((....)))))...)))))).......((((.....))))))))))))).....((((.....))))(((((........)))))..((((((((..(((....(((.....))))))..)))))))))))).).))))))).))).((((((((.......((((..((((...))))..))))(((((...(((((..((((....)))).......))))).....))))).))))))))...((((((((((((((.(((((((.((....)))))...)))).))).))))..))))))).(((((.......)))))........)))))).))))))))))))........))))))))))((((...))))).))))....))))))))))))))..)).).)))))))))))........((((.((((((..(((((((((((((..(((((..(((((((...(((((.(((.....)))))))))))))))((((((((((((..(((((((((((((((.(..((((.(((((.(((...(((..((.((((.((.((......((.((((.......)))))).....((((.((..(((((((.((.((((.((((...)))).))))..)).))))).))..)).))))....)).)).))))..))..)))....))).))))))))).)))))))))).))))))(((....))).........))))))))).))).......)))))))))))))))))))))))).))))(((((..(((((..((((.((((((((.....)))))))).))))..)))))..)))))..........................................((((((((...(((.((((((((((...)))))).......(((((((((((((.................(((((((.......................(((((((((((.((((......(((.(((.(((..(((((((((((..(((.......)))..)).)))))))))..))).))).)))..((((((...))))))((((....((((((((((((((.((((.(.((.((((...)))).)).).))))......)))))))))))))))))))))).))))))))))).....)).)))))))))))))))).))))))))).))))))))((((...((((((...((((((...))))))))))))....)))))))))))))).))))).)))))))))).
Thermodynamic Ensemble Prediction
..{(((,{,{,((({.,((((((.((.(((((((({{(,(((((,,(((,,(((.((((((((((((((((((({({,.((((.((((((.......(((.((....)).))),,......)))))))))),),)))).|||...}}}..))))))))))))))).))).))))))))|...,,,.((((((((.((((((((.(((((.(((...(((((((((((...,{{,{{{.,((((((((((((((.((..(((((.((((...((......))....)))))))))..)).)))))))))).))))((((.((({....}))).)))){{{{{(((((.((((.((((((...((((((.......))))))...))))......)).)))).)))))))}|{((({(,({{,((((((,((({,...,.(((((((....)))))))..,((((.(((((,{,....||}||||}|((((((((.(((....))))))))))),.,{{|{((((.....)))).}})),.,({{{{...,||.||||..,.|....,|||...,.||{|||||}}},}||}}}}}.}})))},.}}|}}}||((({(,(({(((.{(((((((,,,(((.(((((..((((...(((((((((({{....}),)))}|(((((.,{{((((((({,{{{.((((((((({{...}}.)}},.})))|)|...}}})))))))}}},)))))))}))).,,)))).,))))))))))))),})},)}).}}|))}}},}}||||||((((({{.,..(((((((.......)))))))....,|,||||{{(((,,.(.((((({({{|,.....}||.{(((.((((.{(.....)}.)))).))))}}...,.)))}))),)..))})),},...}||||}||||{{||{|||{||||{|||||,{||{|{..{{{,,{{{{,.,))}))|||,||({{||((,.((({{((.....(((((,,,.}}))).,,,|(((((..({,((((.,{|},,|{|,,||||............,,))}}}}}{{||||,{{,||,,|||},||||.,}}}}}),,..}}.}}}}}}((((({(((((((((((((((((((....{.({((.((({...)))))))),..{(((((,.{{,,{{.((((.{{....)))))).,))},,).)))))}....))))))))))))).))))))}.))))),||||||}.||||}||}.||}},...,},,},)))),))},}}})))|||||.{{|||...,|,{{,.,{||,},,}}})))))})))}}.}))}}}})}....{||,|{{,,.,.||||}}}},|||}.||{|{}}||||{{|.||{||||,||||||{{{,{{{.(((((.{{.((((,((({,{.,,||{{{..{{((..{{,,..}}.)))).}))))...,,{{{.....)))|{{,|,........))}..)),)))).}}}}.)).)))))|||||}{,{{((,,|,,.,,,..||||||{|{{{||||||||,|||}},))){{||||||,{||}....))),))))).})),,,,,,....(((((...))))).||,}},)).,))))))))))))),,.,}||||...||},|(((((((..........)))))))}..}}.......))))).))))))...))).)))))))))))))......((((.((...((((....)))).)).))))...{(((((((.(((.{{{.,.((((.(.(.((((((((.((((.(.(((((.((({{(((((((......))))))).{{{...{((((((((((((((.((..((((((...(((.(((,{(((.(..(((((((((.(((((((.(((((.((((.....))))..))))).))...))))).))))).(((((((((.((((((,{{{((,.,,||||,.((({,((((((..((((({{{...}))}...,)))).......,{.{{.((((......)))).)})))))).(((..((((((.((((((((((((((((((,,...,.))))))).))))(((((((((.{(..{((((.(((,,,{(((((.{((((((.((........,....,...)).))))}},}......,((((........((((.(((.((((((((.((.((((((..((((......)))).(((((....}))))..,,....,.|{{{||{||,,..,{{,.....(((((....})))),({(.((.....,,,.}},}||.{(((((((((.((((,,..{.(((.(((((((((((........)))))............(((((.(((((.{((((.(((,,,,..((((((((.((((..((....))..))))))),.,,((((..(((((.......))))).)))))}}))))),.......(((....)))(((((((.,.......,.)))))))))).))))},})))).))))).,......))))))))),)))))...)))))},)))}.,,.|,,,...}))})))))..{{{.....)))(((((((.((((((...))))))))))))))))))).)))))}.,)))).))))))).))))|.(((((.((((((.....(((((((,..,.(((........))){((((.....))))}((((((((((.,....{((((((....))))))}.((((((.{.(((((..((((((((((......))))))...,.{(((((...((((((((....)))}})))).)))))},,,,|,((((......)))).,....))))))))),.)))))){(((....)))}}.))))))))))}.)))))))..)))))).))))).,))))))))))))))})}.)))))))))))))))).))))))))),,..})))),,}},,}},}},(((((....)))))...)))))).......((((.....))))))))))))).....((((.....))))((((({,...,}.)))))..((((((((..(((....{{{.....}}})))..)))))))))))).).))))))).))).((((((((.(({.{.({{(..((((...})))..))))|||,|,{|||,,,})))}|.....}}}|.,|...{{{{,....}))))}.))))))))...((((((((((((((.(((((({{((....)))))}..}))).)))},)))..))))))).(((((.,...,.))))).,......)))))).)))))))))))}...,))))))))))))))((((...))))).))))....)))))))))))))).,}}.}.))))))))))|(((((.(((((((,((.,...{{((((((.......)))|,}}{((((((...(((((.(((.....))))))))))))||},{,..,,...,,..}})).))))))).))))),(((((..(((((((((((((..{((((({.,,,{|......((.((((.......}))))}.....,,,{{(({{((,(((..,{,(((((((((((((({.{{(,...)),|{{{,.....)),|{((....(({.{({.....))).)))...)))).,,))))))),.}})))))))..))))}{{|....)))|(((((((((.{{...(((((....{.{((({...{.{.((((((((..|..(((((((((((..(((((..((((.((((((((.....)))))))).))))..)))))..))))),{.{(....}}.},.................))))))..,..))))))))},.)))))}.(((((({...}))))))....)))))}}.)))))))))}.........}))))}.,}}}.,}}))))))))))..)))),...(((((((((((.((((.,,,..(((.(((.(((..(((((((((((..(((.......)))..)),}))))))))..))).))).))),,((((({...)))))){{{{....{(((((((((((((,((((.(.((.((((...)))).)).).))))......))))))))))))))))),)))).)))))))))))..))))))))...,,.....}))..))))).))).)))))))){(((...((((((..,(((({{...}))))))))))).,..)))}...|||||,...))))})))}}.)))).

Transcripts

ID Sequence Length GC content
AGUUCCAGCGCAGCUCAGCCCCUGCCCGGCCCGGCCCGCCCGGCUCCGC… 4353 nt 0.6265
Summary

Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008] CIViC Summary for EPHB4 Gene

Forensic Context

A study in mice demonstrated that the EPHB4 serves as a specific marker for venous endothelial cells within the heterogeneous cellular populations of interscapular brown adipose tissue, as identified through single-nucleus mRNA-sequencing [Behrens et al. DOI:10.1016/j.molmet.2025.102252].