Basic Information

Symbol
AHR
RNA class
mRNA
Alias
Aryl Hydrocarbon Receptor BHLHe76 Class E Basic Helix-Loop-Helix Protein 76 Ah Receptor Aromatic Hydrocarbon Receptor AH-Receptor BHLHE76 FVH3 RP85 AhR
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001621.5
Sequence length
6243.0 nt
GC content
0.4077

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1950.08 kcal/mol
Thermodynamic ensemble
Free energy: -2066.01 kcal/mol
Frequency: 0.0000
Diversity: 1497.82
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((.(.((((.(...(((((((......)))))))...).))))).))))))......(((((((((.(..(((((((((((.((((((((....(((((((((((((((.(..(((..((.(((((((.(((..((.(((.((((((...)))))).))).))..(((.(((((....((((......))))))))).))).((.((((((((((...)))).)))))).))..((......))..(((....)))((((((.(((.........))).)))))).))).)))))))))...((((((((..((((((((((((.....))))).((((((((((((((((((((.(((((.....((((.........(((((((...((((.......))))..))))))))))).))))).))))))..))).)))))).....)))))((((....))))..(((((.....)))))..)))))))..))))))))....((((((((((.((.((((((....))))))...)).....)))))))))))))..).)))))))))).))))).(.((..(((((((...(((((((......(((...((......)).....)))......)))))))...)))))))..)))(((((........))...)))..))))))))((((((...........))))))...............(((((((......))))))).)))))))))))..).))))))))).......((((((((.((((((((.....)))))..(((((((.(((((....((((....))))))))))))))))(((((((((((((.(((..(((((..(((.(((.......))))))..))))).....))).))))))....))))))).((((((.......(((((......)))))....)))))).((((.(((((((((((.(((.((.....((((((((((.((((((........(((........)))((((((((((((((.(((.((((((((...)))))))).)))...((((.(((((((((((..((((.(((((((...))))).))...(((((((((............))))))))).....((((((...(((((...........(((((((......(((((....))))).......))))))))))))))))))...((((((......))))))..............))))..)))).....)))))))))))((((((((((((...(((((..((((...((((.........)))).)))).................(((((((((......((((..((.((((..(((((....((.((((.....(((((((((((..((((..(((((.((.((((.......(((((....)))))..............((((((((((((.(((((......))))))))......((((((((......))))))))(((((..........)))))((((((((((((.........)))))))).))))...))))..))))).....)))).))..)))))..))))....))))).))).))).....))))))..)))))...)))).))))))....)))))).)))...(((....)))))))).....))))))))))))(((((....)))))....)))))).))...)))))).)))))).))))))))))..)).)))..))))))))...))).))))...........(((((((.((.(((((.....)))))))...)))))))((((((..(((...(((((....))))).)))...)))))).(((((((......)))))))...(((..(((.((((((((((((((((..(((...((..((....))..))...)))......))).))))))..............(((....((((((...)))))))))....(((((((.....))))))).(((((((((.((((.(((((..((((......)))).)))))((....))......(((((((.(((((...((((....(((((..((...(((((......)))))...)).)))))......))))))))).)))))))....(((((((......(((((..((((((((((((((((((((.((((((.(.(((...((((..((((((.........(((((((.....)))))))..((.((((.(((((((.((..((((.....(.(((((((.(((.(((((.....((..(((.....)))..))....)))))..))))))).))).)......))))..)).))))))).)))).))...((((((((((((((.(.(((((((((.(((((((((......(((..(((.((((((((((((((.((((((....)))))).....(((((((((((((((.........)))))).....((((((........)))))).(((.(((.(...(((((((((...(((.........((((((.((((((((((((.....(((((...((((((.((((((.........((((((((((((.((.......)).)))).))))))))..(((.(((((((((((..................)))))).)))))..))).....))))))))))))...)))))......(((((.((((((...))))))((((((..(((((((((......((((.............(((((...)))))...(((((.((((((..((....))..)))))))))))((((((((.((.((.((.((....))..)))).)).))))((((....)))).....(((((((......)))))))..))))..))))......)))))))))..))))))((((((((....)))))...))).((((((.....................................)))))).............((((((...(((........))).))))))....)))))...........((((((.(((..........)))..)))))).......)))))))))))))))))).............))).))).))))))...).)))..)))..(((((((((((......((.............((((((((.((((((((.((((.......(((((((((.((((..((((((...................................(((.((((.((((((((((((((.........)))))))..))))))))))).)))...........((((((((..(((.((((((((.((........((((((..((((.......))))..))))))...(((((....((((((.......))))))...))))))).)))...))))).)))..)))..))))).((((((((...))))))))..)))))).)))).)))).)))))....)))).))))))))...))))))))..............))......)))))))))))..........)))))))))..((((((..............((((........))))(((((.....)))))((((((((..(((........)))..)))).))))....((((((((...)))))))).............................)))))).......)))))))))).....)))).)))..))).....))(((((((.............))))))).....(((.(((((......))))).)))...)))))))..(((((((((((((............((..((((...((((((...(((((((((((.(((.....)))))))))).))))(((((((((((..((.((((.((((..((..((...((((((((.((((.......((((((.(((((..((((((...(((.((((((((((((((..(((((((((((...((((((.(((((((((((((..((.(((((.....))))).))..))))).))))))..((((..........)))).......((((..((......))..))))................((((..((....))..)))).....(((((((((((...((((((((.....)))))...))).)))))))))))...)).))))))))))).))))))....))...)))))))))......))).)))....))))))..)))))))))))(((((....))))).((((((((((((((.((((((.....((((.((((.......)))).)))).((((.((((((...(((((.........)))))...)))))).)))).....))))))...)))))).(((((((((((.........(((((((......))).))))((((.........)))).....((((((...........))))))((....))..............))))))))))).(((((......((..(((((((.............)))))))..))..((((((((((((((.((((..(((((((..((((..(((....((((((((((((((..(.((((((((((..((((((((((...(((((((((((.((.((((((((((((((((((((.((((.(((((((((((((((.((((((((((((((((((((((((((((((((((((((((.(((((((((((((((((((.(((..(((((((...(((.(((((((..((((.((.(((.(((((.((((((.(((((((((((((((((((((((((((((((((((((((((((..(((((.......)))))..))))))))...............((((((..((((..((((.((((....)))...).))))...))))))))))..........))))))))))))))))))))))))))))))))))).)))))).))))).))).)).))))))))))).)))...)))))))..))).))))))))))))))))).)).)))))))))))))))))))))))))))))))))))))))).))))))))))))))).)))).)))))))))))))))))))).)).)))))))))))...)))))))))))))))))))).)..))))))))))))))...)))..))))..)))))))..)))).))))))))))))))....((((((((.......((((........))))........))))))))......)))))))))))))..))))...))))))))....))....))..)))))))).))...)))))))))))))))))..))))..))((((((..........))))))))))))))))))).....((((((((((...))))))))))................................((((((((((((..(((...((((((((.(((.....((((.((((((((((...)))))))))).......(((((((((.....(((...(((((.............)))))...)))......)))))))))....(((((((........)))))))..........)))).....))).))))))))....)))......((((((........))))))((..(((((...((.(((....))).)))))))...))..)))))))))))))))))))))).)))((((((((......))))))))..............)))))))))))(((...((((.((.....))))))...)))..)))))).))))....))).).)))))).))))..)))).....)))).))))))))))))).....((((((((.(((.(((.....))).))).)))..))))))))))))..........)))).)))))))))))))))).))))))))).))))))))............((((((((......)))))))).................
Thermodynamic Ensemble Prediction
.,,((((((.(.((((.{...(((((((......)))))))...,.))))).)))))},.....{((((((((.(..(((((((((((.((((((((....(((((((((((((((.(.,(((..((.(((((((.(((..((.(((.((((({...}))))).))).))..(((.(((((....((((......))))))))).))).((.((((((((((...)))).)))))).))..((......))..{{{....}}}((((((.(((.........))).)))))).))).)))))))))...((((((((..((((((((((((....{||,||.((((((((((((((((((((.(((((.....((((.........(((((((...((((.......))))..))))))))))).))))).))))))}.)))},))))).....)))))||,|}}.,))))..{((((.....))))}..)))))))..))))))))....((((((((((.(,.((({((,...,))))}...))}..,.))))))))))))).,}.)))))))))).))))).{.((..(((((((...(((((((......(((...((......)}.....)))......)))))))...)))))))..))}((({{........}}...)))..))))))))((((((...........))))))...............(((((((......))))))).)))))))))))..).))))))))}.........(((((({...{((((.....))))}..(((((((.(((((....((((....)))))))))))))))){(((((({((((({{{{..,{(((..{{{.({{.......})))))..||||}..,{{|||,|||||,...,|||||},.{(((((.......(((((......)))))....))))))}}}}}.,|||{{{{{{{.||||||..,..{(((({((((,((((((,,...{{,({{........))},,,{(({(((((((,(((.((((((((...)))))))).)))..,((((.(((((((((((..((((.(((((((...})))).}}.{.(((((((((.{..........))))))))),....((((({..,(((((...........(((((((......(((((....))))).......))))))))))))))))))...((((((......))))))..,.........,,))))..)))),....}))))))))))|(((((((((((,,..,,(((((((...)))))},....,..,|}}||{|{,,},....{,,.,(({.,(.((((........)))).}}..{,{(((({{(...,}}}.}))}},}}}.,}}},}}},,..||||..,,}}},|}}|}||..........(((({{{{({{,..........,,.,.{.(((((((....))},)))).},,..,},..,..,}))))}}))))}...{(((((((.((.(((((..((((((((((((((((.(((.......{.(((((..,.{{|.{(((((((({..(({{{..{{.......,,..},.))),},...)))))))))))).,..))))).}.......,,.,}}).)))}}))))))))),..)))..))))))))))))))).....,,))))))))))),{{|{....))))},,,,))))}}.}},..}}}||||||}|||.|||||}}}}|..,..,}),.}))})}}}|||{{{,{.{{{{,,,,{,{{{{{,{{{{,,||(((((|,.|||)}}|||...|||||||((((((..(((.,,(((((....))))),)))...))))))...,,))})))).,}}||||.........,,,.,,||||((((,,.......}}}}.||,...,,.})).}})}.}})))})}},{((((({....,}}}}}}......{||,},.((((((...)))))),,.....{((((((.....))))))}.{((((((((.{(((.(((((..((((......)))).)))))((....))......(((((((.(((((...((((....(({{{..((,{{(,(,({{....))),).}})).))))}......))))))))).)))))))....(((((((..{{,.{((((..{((((((((((((((({({{,(((({{.{.{||||.{{||,|((((({,,...,,,,|((((((.....))))))}.,((.((((.(((((((.((..((((.....{.((({((,{(((.(((((....{(({,{{,.....,))}}).....)))))..))))))).))).}......))))..)).))))))).)))).))...(((((((((((,{,.,.(((((((((..(({,,,||{{{(((,{(..,{(,((((((((((({((.((((((....)))))).....((((((((({{,{((,,,.....,|||||,.....{(((((........))))))}|||||,{,,..,{((({{{{{...{{{.........{{({{{,((({{{{{|||{..,{{((((({..(({(((.{{{{{,......,,,||{{{{||||||,||.......||,}|||.}}}}}})},|||{.{((((((((((..................)))))).))))}.......{{{|||||,}},,,}...,)))))))}..,,,,,.((((((...))))))((((((..(((((((((.{{...((((..........,..{((((...})))}...{(((,,((((((..((....))..))))))))))}((((((((.((.((.({.((....}}..}}}).)).))))((((....)))).....(((((((......)))))))..))))..))))...,,.)))))))))..))))}|((((((((....)))))...)))}{((({{.....................................}}}}}}.,,,.........((((((...(((........))).))))))....})))),.....,{,,.{(((((,({{..........})),.}})))),},....}))))}}}}|}}}}}}}},...........,}}}.}))||))}}}...},,,},,}}}.,(((((((((((.,.,,.,,.............((((((((.((((((((.((((....{{{({,{{(({(,{{{{..{(((((.............,,,|,.......{{{{{,.,,,(((.((((.((((((((((((((.........}})))))..))))))))))).)))...........(((((({{..(((.((((((((.{{.,,,,,,.{(((({..{{{{,..,,,,)))}..}))))|{{.(((((....{{{{{{.,,.,..}))))}...))))))).,}},..))))).)))..)),.,))))).((((((((...)))))))).,))))}}.}}}},)))).,)))},...)))).))))))))...)))))))).,{{{,,....,,,}).,....})))))),,}},.....}}}})}}}})))),,((({{,..,,,,........((((........)))){{((({,...}}}}}|{(({{{{..{{{........}}}..}}}},}}}.....((((((((...))))))))................,,,,,,.......||||||,,..,,,|}}}}}|}||{||,|,}}}.,,,.|||||{,{||}|,,{{{(,.,......,,,,||||,}},,...{{..,.{{|||,,,....)),}},..,,))}|,.,}}}))}}..|{{|||,,.{{{{{{{,,{{.,,,({{{({....,,,{({{{,,{{{,,,,,.....,,}}}}))))}},}.}|||}}}}}}|..||}}}}|||{{{{,.,.,}}}}.,,,.,,....,}}}}}}}}}.,,,,,.,,{|,,.,,),}))},)))),.}))}}},.,|||,..,,,,(((,,,....,|||...((((((((((((..((.(((((.....})))).))..))))),,)))))}.|{{({{{...{{{{||||,......((((..({,.....})},)))}.,,,,,,,.,,,}},|((((..(({{.{||{{|,||,....(((((((((((...{|((((((.....))}}}}|,||..)))))))))))..|{|{||||||{{|}|||}||||,|||{{{.|||||||,{|,,,.,,)))}.,,))))),)))}|},}}}|}|||}.{,,||,,.,})))},,},))))))))))))},}},}}},.,||||}{}||}..}}}}),|||{{{|.,{(({((((,({{{.(((({{......{{{{{({.{{{,.,,,},......,,,|||{,((((((......)))))).}}},.,....{(({{{{......}}}.||||...((((((((((.((((((..((((..(((((((((..((((({...,((..((.(((((....(((((({{((..((((((((((((((....(((((((.(((.({.....)).))).))))))}((((((((((((((((((..(((((((..((((..(((,{..((((((((((((((..(.((((((((({.,((((((((((...(((((((((((.((.((((((((((((((((((((.((((.(((((((((((((((.({((((((((((((((((((((((((((((((((((((((.(((((((((((((((((((.(((..(((((((...(((.(((((((..((((.((.(((.(((((.((((((.{((((((((((((((((((((((((((((((((((((((((((..(((((.......)))))..)))))))).....,.,,,,,..,||{,,,..,|||..||{|,,(((....)))..,|,||||{{{|.,.,)))))..,}}}},..))))))))))))))))))))))))))))))))))}.)))))).))))).))).)).))))))))))).)))...)))))))..))).))))))))))))))))).)).))))))))))))))))))))))))))))))))))))))}).))))))))))))))).)))).)))))))))))))))))))).)).)))))))))))...)))))))))))))))))))).)..))))))))))))))..})))..))))..)))))))..)))),)))))))))))))}................{(((((......)))))}.....(((.((((((((((.{(((((.........)))))}...(({{{{{{{..{{{.,,{..{{{{{{..{{((({{.........((((((((((.{{.(({..{(((....})))})).}).))))))))))|||||{|.....((((((((((...)))))))))).,,,,,....}})))})})))})..}}}.}},..}})}..}}}}}}..))))))))))))).........)))))))..)))))....))..)))))....)))).,..)))))..))..))))))))..)))))}})))..)))).)))))).)))))))))).,||,.,.,|||,((((((((..{(({{............)))))..)))))))},,........|,,......,,,}}}})}},},.,)))}})),}}}),)),,}}}}}},.,,}},}))}))})))})),)))))))},....}))))))))..},|((((((((......))))))))}.......,,....)))))))))))(((...(({(.{{.....})}))),..))).|}|}))|,}|)}....|}},}.}))))),))))..)))).....)))).))))))))))))),|...,{{{|{{{.{{{.(((.....))).})).})),.)}}}})))))))..........)))}.))))))))}.}}}},,.)))},}}}..,}}}},,,,,,}}},,....((((((((......))))))))..})))))}........

Transcripts

ID Sequence Length GC content
AGUGGCUGGGGAGUCCCGUCGACGCUCUGUUCCGAGAGCGUGCCCCGGA… 6243 nt 0.4077
Summary

The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. [provided by RefSeq, Sep 2015]

Forensic Context

A study in mice demonstrated that the AHR is part of a common peripheral blood gene expression signature for anterior hemibody irradiation across multiple doses, and these signatures predicted radiation status versus non-irradiated controls with high accuracy (79–100%) [Meadows et al. DOI:10.1371/journal.pone.0011535]. In a human study, the AHR was discussed in relation to its links with inflammation and dietary factors, and its associated gene AHRR showed differential methylation patterns in heavier monozygotic twins with lower leisure activity and altered sucrose consumption [Kibble et al. DOI:10.1098/rsos.200872].