| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUUUCCCAGAUAGCACGCUCCGCCAGUCCCAAGGGUGCGCAACCGGCU… | 1662 nt | 0.6396 |
This gene encodes a secreted, glycosylated cytokine composed of four alpha helical bundles. The encoded protein is mainly synthesized in the kidney, secreted into the blood plasma, and binds to the erythropoietin receptor to promote red blood cell production, or erythropoiesis, in the bone marrow. Expression of this gene is upregulated under hypoxic conditions, in turn leading to increased erythropoiesis and enhanced oxygen-carrying capacity of the blood. Expression of this gene has also been observed in brain and in the eye, and elevated expression levels have been observed in diabetic retinopathy and ocular hypertension. Recombinant forms of the encoded protein exhibit neuroprotective activity against a variety of potential brain injuries, as well as antiapoptotic functions in several tissue types, and have been used in the treatment of anemia and to enhance the efficacy of cancer therapies. [provided by RefSeq, Aug 2017]
A study in human autopsy cases demonstrated that postmortem serum erythropoietin (EPO) levels are stable within 48 hours and can serve as a marker for anemia or hypoxia related to the fatal event [Quan et al. DOI:10.1007/S00414-008-0276-9].