Basic Information

Symbol
ERBB4
RNA class
mRNA
Alias
Erb-B2 Receptor Tyrosine Kinase 4 HER4 ALS19 V-Erb-B2 Avian Erythroblastic Leukemia Viral Oncogene Homolog 4 Tyrosine Kinase-Type Cell Surface Receptor HER4 Human Epidermal Growth Factor Receptor 4 Receptor Tyrosine-Protein Kinase ErbB-4 Proto-Oncogene-Like Protein C-ErbB-4 EC 2.7.10.1 P180erbB4 V-Erb-A Avian Erythroblastic Leukemia Viral Oncogene Homolog-Like 4 Avian Erythroblastic Leukemia Viral (V-Erb-B2) Oncogene Homolog 4 V-Erb-A Erythroblastic Leukemia Viral Oncogene Homolog 4 EC 2.7.10
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_005235.3
Sequence length
12097.0 nt
GC content
0.3956

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3218.50 kcal/mol
Thermodynamic ensemble
Free energy: -3459.02 kcal/mol
Frequency: 0.0000
Diversity: 3194.69
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((..(((....((((((...((((.......(((....)))......))))......)))))).......((((((..(((((((.(((....(((...((((((((((.......(((.(((..((((.....)).))..))).)))))))))))))..........((((((.((.......))))))))...))).))).).)))))).))))))(((((((....)).)))))((((((((((..(((((..((..(((((......((((((.(((((((.((((((((((((((((.(((((((((((((((((((((.((((..(((....(((((((((...(((.((((((((((((((......(((((((((...(((((........))).))....))))..(((....))).........(((((((((((((...)))))))(((......)))...(((((((..(((((((........)))..)))).)))))))....))))))(((((......)))))......))))))))))).)))))..((.(.((((.........)))).).)))))..)))...)))))))))...((((.(.(((...(((((........)))))..(((......(((((((((.......(((((...............))))).......)))))))))......)))............(((((.((((.(((((.(((.((((((((((.((((..((..(((((((((..(((..(((((......)))))....))).(((.((((((((((......))))..)))))).))))))))....))))..)).))))...))).)))))))..........))).))))).)))).)))))))).).))))...))))))).))((((....))))))))))))).))))).........)))))))))).)))))))))(((((...((((((((.(((((........))).)))))))))))))))..(((((.((((((((.......................((((((((((((((......(((.(((((..(((((((.....(((((((......)).)))))(((((......)))))..(((((((.(((((....((......)).(((.(((((...))))).))))))))..)))))))...)))))))....))))).)))....(((((....(((((.(((((((..((.(((((..(((((((.(..(..(((..((((((((.((((...))))...))))))))..)))..)..).)))))))((((........)))).(((..((((.((((((.(...........).))..))))))))..))).(((.((((((....(((((((.((...)).)))))))....)))))))))......((((((((.........))))))))(((..((.((((((((((.(((((...)))..)))))))))).)).))..)))..))))))).))).))))..)))))....))))).............))))))))...)))))).....((((((((...........((.(((....))).)))))))))).........((((((.(((((..(((((((((((((.......((.((.........)).)).(((((((.....)))....))))..))))))))).(((((.....)))))..)))))))))))))))...))))))))))))).(((((....))))))).))))))))))))).....)))))..))..(((((((.........))))))).............((((((.......))))))(((.((((((((((.(((((((((((((((..((.((.......)))))))))))....)))...)))))........((((((..(((((((.........((((((((........((((......))))((((((.....(((((((..((((...............)))).(((......))).)))).)))..))))))..........(((.(((((((((((((...........)))))...)))).)))).)))..))))))))........((((((...(((((((..(((((((((((.......)))))))).))).......)))))))..)))))).((((((((.........))))))))....))))))).........(((((((..((((.(((((((((.(((.(((((((((....)))))))))((((.(((.....((((..(..((((((..(((...........)))..))))))..)..))))....))).)))).((((((((.......(((((((....((((((....)))))).......)))))))....((((((.((((((((...........((.((((((((((.....((((..((((..((((.((((((..(((((((.((.((((..(((((..(((.((((((((((......))))))))))....((((...(((((......))))).))))....)))..)))))..))))))))))))).)))))).)))).(((........)))...))))..)))).....)))))).)))))))))))))).))))))...))))))))..((..((((...))))..))(((.((((((((((((....((((..((((....((((.....)).))...))))))))..)))))).)))))))))..(((((((((((.(((((.((..........(((((((((((....(((((...((((..(((((((((.....(((((.(((...(((..((((((.(((..(((.(((((((....)))).))).)))...)))..)))....)))..)))...))).)))))..))))))....)))..)))).))))).....((((((((((((.((.(((((((((((((((((((.((..(((((...............)))))..)))))))).((((.(((..((((((.((...............)))))))))))..))))))).)))).))).........(((((..((((((...((((((((.(((.(((((((((((.((.(((((((((((((...(((((((((.((((((.....)))))).))))))))).....(((((((((.((......((((((((.......(((.(.((((.((((((((((.....(((((((((.(((.((((((..(((.(((.((((..(((((..((((((.(((((...(((......)))))))).....(((.((((((......((((((((((((.((..((((((((((((((((((..(((((((......................))).)))))))))((((((((((.((.(((.((......)))))..)).))...))))))))(((((.(((...)))......(((((....)))))((((((...(((((((.((((((((.......(((((((((.((...(((..(((....)).)..)))..))((((..(((....))))))).....(((((.(((((...............((((((((((((.....)))).(((((((...((....((((((..((((((.((((((((((........)))).))))))......(((.((((((..(((.((((.((((((((((.......))).))).))))...)))).))).....(((((......)))))..((((((..(((....((((((...(((((((((((.((((......)))).....(((((.....(((((((((((..((......((.((........)).))(((.....)))..((((..(((((((...............((.(((((((.......))))))).)).((((((............)))))).......((((....))))...)))))))....)))).........((((((........))))))..))...))))))))))))))))(((((((......)).)))))..................)))))))))))(((.(((((((((((((((((((((((((.....((((....))))(((((((....((((((.(((.((.(((..(((..(((..((((......(((((((((((.....(((((((....((((((((......)))))))).)))))))((((((((...(((((((((.(((((((..(((((((((..((((((.....((((..((((.............)))))))).....))))))...)))))))))....))))))).)))))(((((.((((...............)))).))).))))))...))))))))((((.((((((......)))))).)))).((((.......))))..(((((..(((......((...((((((.......((((.......))))........))))))...)).....)))...)))))..)))))))).(((((..((.(((..((((((..(((((((((((.........(((((((.............................))))))).............)))))......))))))..))))))..))).))..).........))))....(((((((.((((.(((((.....((..((((.((((......)))).))))..))))))).)))).))))))).(((((..(((((.......)))))..))))).......)))......))))..)))..)))..))).)).)))))).)))....)))))))........................(((((............)))))..)))))).....)))).)))).........).)))))))))).)))....))))))....)))..)))))).......((((.....)))))))))).))).))))))..))))))...))...)))))))))))))))))))).)))))....)))))))))))))....(((((((((((((((((.((....((((((((((((.((((....(((((.(((..............))).))))).((.....))..........((((.(((...(((((....)))))))).)))).....((((((((..(((((.((.((((((((.....((((((...((((...(((((((((((.((...............)).))))).))).))).))))..)))))).))))))))...(((((((.((((....))))..)))))))...)).))))).....))))))))...(((((((((..((.....(((((((((..(((((..................((((.(((((((((.....................(((((((((....)))))))))....((((((......(((.(((.....))).))))))))).))))))))))))).......(((....)))..............)))))))))))))).....))..))))))))).((((.((((((.((((..((....))..)))).)))))))))).)))).))))))))))))(((((((((((((((.......))))))................((..(((((....)))))..))........((((((((((((.(((((.....)))))...........(((((((((....)))))))))........((((((...(((((.........((((((((.(((((.(((...............((((((((((((((..((((.........((((((((...(((((((..((((.....(((.(((((..................((((((....((((((.(..((((((...))))))..).)).))))..))))))(((.(((((..((((..(((.....(((((((((...(((((((..(((((((((...)))))))))...(((((((.((.........)).)))))))..((((....(.(((((((.........))))))).)...)))).)))))))......))))..)))))....(((((.((((............))))))))).....(((((((.........)))))))...........)))..))))..))))).)))....((((..((((.....)))))))).........................))))))))..))))..).))))))..)))))))))))).....))))))))))))))......(((.......)))......((((((((...((((((.((((((.(((((((((((((....))))...(((((...........))))).........(((((((...((((((.....((...)).....))))))...)).)))))((((....)))).(((((.((((.((.((((((((...........)))).)))).))..)))))))))...............))))).)))))))))).))))))..))))))))...))).))))).)))))))).....)))))...)))))).((((((((((......((((((((..((((((((((.............(((((((((((.....))))))))))).............(((.(((((.(((.......)))...))))).)))......(((((((((((((((...))))).....))))))))))....))))))))))......((((.......))))..........((((....)))))).)))))).....(((((((....))))))).(((((((((((((...........((((....))))..((((........))))....((((((((((.....))))..)))))))))))))).)))))..)))))))))))))))))))))).....((((((.....((..(((((((...((((((((.(((((.((((..(((((((((...))))))..(((((((..........)))))))....((((...(((((((........(((((((...................))))))).........((((((((((((((..............((((((....)))))).........((((((...(((.(((((.((...((((((((((((...))))).))))..(((((.((.((((((((......)))).))))...((((((((((.((.((((((.((.......((((((((.((((((((((....)))))...........(((.((......)).))).................................((((((.(((.......))).((((((((((.(((((((((...............))))))))).))))))))))(((((((((((((((((((.(....((((...(.((((...)))).)...))))....).)))))).))))))).))))))......................))))))))))).))))))))((((.....(((((.((.......)).))))).....))))...............(((((((((((((((.....(((((...(((((........((((((..(((((.........)))))....)))))).........))))).))))).....(((((((((((((((((((((((..(((((..(((.((.......)).)))))))).)))))))).....(((......)))........(((((...)))))...)))))))))))))))...)))))))))))))))...................(((....))).(((((.(((((..(((...(((((((...............(((((..((((((((.(((((((.((((((..(..((((((.((((.....(((((((((..(((.(((((((....(((((......((((.....))))....((((....))))....(((((...........)))))....(((((((((....((((........))))......((.((((((((......)))))))).))..((((((...........((((....))))............))))))(((((....((((.((((((((.((....)).)))).)))).))))...)))))........)))))))))))))).)))))))))).))))))))).......)))).))))))..)......))))))...))))))).((((((((.................((((.........)))).......(((((((......)))))))....((((.((((((.((((((....(((....)))...)))))).))).))).)))))))))..))))))))))).))))).....(((.(((........))).)))....))))))).)))..))))))))))((((((....(((((((((((........)))))).))))).................((((.(((((.......((((.(((((((((((((.(((((((((..(.....)..))))))).............)).))))))))).))))..))))......((.(((((((((((........((((......)))).((((((((..((((((..(((.........)))..)))))).))))))))..................(((((((((.((.....)).))))))))))))).))))))).)).........((((((((((((............)))))..))))))))))))..)))))))))).)).)))))).)).))))))).))))).)))))..(((((...)))))(((((((...(((((((((........((((((....))))))(((((((((..............((((......)))).......((........))(((((.....))))).(((.((((((.........)))))).).))...((.((((....))))))....(((((((((.(((((((((((.((((((((((....))))))..(((((..........)))))....))))...(((((.(((((((((....))))))))).))))).......((((.(((......))))))).))))).)))))).))))))))).)))))))))(.(((((.(((((((...))))))).))))).)............))))))))).)))))))..)))....)).))))))))...))))))))).)))))))))))......)))))))...))))..........)))....))))..))))).)))))...)))))))))).))...)))))).)))))))))...((((((((..((.(((((....))))).))..)).))))))..)).)))))))))......)))))))).(((((((((((.(((((....))))).((((((....))))))......)))))))))))..((((.....))))((((.(((((((((((((((.((((((((((.....((....((((((........((((.((((....((((((........((((((....(((....((((((((((........((.(((((......))))).)).........))).))))))).......)))....))))))........))))))...)))).))))(((((((((..........((((((....(((.((((.((..............))..........(((((.....)))))............((((((.(((...(((((....)))))..))).))))))......)))))))..)))))).........)))))))))))))))....(((((((((...(((.((....)).)))...)))))))))...(((((((((((......))))))))))))).....))))))))).)...)))).....).)))))))))))))).)))).)))))))..))))))............))))))))))))))....((((.....))))))))...))..))))))....)))))).)))))).)))..((((((((................))))))))...........))))))))))).)))).)))..)))..))))))..))).))).....))))))........))).))))))))))).))))))))))))...)).))))).))))(((((((((....((((((....))))))((((.....))))....((((....)))).....)))).)))))(((((((((...)))))))))....(((.((.....)).))))))))))).((((((((((((((..(((((((((((....((((((((((((((((((((((((((((...(((.(((.(((.((((((((((((((((((((((((((((.((((((((.....))))....))))...)))).))))).((((((.(((((.........))))).............((((..((....))..))))..((((((......))))))..........))))))..........))))).)))))((((((...((.((.((...((((...))))...))))))..))))))))))))))).))).))))))...)))))).((((((.(((((((...(((((((((...(((((.((((((((.....)))).)))).(((((........)))))((((...)))).)))))...))))))))).))))...)))..)))))).......................))))))))))))))))))))))................((((((((((...((((((....))))))..))))))))))..((((((((...)))).)))))))))).)))))......((((((....(((((((....(..(((((..((........))...)))))..)...)))))))....))))))...))))))))))))))............)))))))))))))).))))..)))))))))))))))))..))))).....((((((((..((((.........)))).......))))))))((((((((...(((((..((((((.........(((((((((..((......))..)))))))))))))))..)))))...((((.........))))))))))))....))).)).))))))).))))))))).))))))))))))))...))).))))))))..(((((((((((...........).))))))))))((((.(((...(((((....)))))....))))))).....))).))))))))).))))..)))))))((............))))))))((((((...(((........)))..)))))))))))))))).))).))))).)))).))))))......)))..)))....((((((.(((((((...(((....((((((........))))))..))).)))))........)).))))))....
Thermodynamic Ensemble Prediction
...(((.((((((.(((((...)))).(((((.(.{(((((((((((((((((......)))),,,,..,.,((((((..((((((,,(((,...(({...((((((((((.......(((.(((..((({.....)),,,..))).)))))))))))))...,...,,.((((((.((,,....,}}))))))...})).))).).)))))).)))))),,{({((....}|{||,,,...}}}}.,...}),,,,.((..(((((......(((((,,(((((((.((((((((((((((((.((((((((((((((((((({{.{{((,,{({,...(((((((((...(((.((((((((((((({,.....{((((({{{...{,{{(..{,{,..|}},||,,{.}}||..,||,|..||,||,,,,..,{(|{{{(((({((.,|||}},}||((.,,...)),}..{{({{{{..,{(((((........)))},})}},)))))}}|..{||||,|(({{{..,,..)))))},,...})))))))))).)))))|{({.(,{{{{......,..,))),)})))}}..)))...)))))))))...{(({.,.|||...{{{{{........,,},,,.{((...,..(((((((((.......(((((...............))))).......))))))))).,,...}},,,,.....}}..(((({.((((.(((((.{((.{(((((((((.((((..((..((((((({,..|||..(((((......)))))..{{{||{(((.((((((((((......))))..}))))).)))})))))}..))))..)).))))...))).))))))}..........))).))))).)))).}))))})}}),|}}|,..|||||}}.}},,,|},.,))},))))))))).)))))........,))))))))))}})))))))|(((((...((((((({,(((((........))).))))))))))))))),.(((((.((((((((....,,{....,,.......,,,(,.(({{(((((((({{..,{({..(((..((((({{,.,,,((({((((,,,,,.}|}},}}}(((((......))))).,{{{||{|.,((((||||||{{||,.,,.(((.(((({...))))).)))|||....{(((,.......(((((,...}))))).......,,)))}....}}|{,{{{||}|,.{|||||||,.{{((({({(,,(..{{{.,((((((((.((((...||||...}}}}}}}}..}}}..|.{|{|||||,,,,,,.)))}}}}},,,.{{{.,{||{,|{{{{{{{,,......,,,},,.,}))}}|}}},.},,.(((.((((((....(((((((.{,...}}.)))))))....)))))))))......((((((((.........)))))))).,,}}||}||{,,{{{{,,|{{(({..|||{{||||{{|||{{,,,,,..|||{|||(((||,(((({......))))),,}))})),..,...,.,,..}}||||||..,||}.}|,.,|,||{{{{||..............|||,,,.)))...))))))))},}.,},,.{{{,,.,|||||..,,|||||||{{|{||||..,||,|{,........}}.}}}}},,|||,...,))}....}))),,))))))))|.{((((.....))))).}))))))))))))})).,}))))))))))))).(((((....))))))).))))))))))))).....)))))..))..(((((((.........)))))))..})))}......((((((.......))))))....)))))))))))).}.,.,.))))).((((((((((....(((((((.....(((((((((....(((..(({{{{.,....})}({{.((.,......)),))}......)))..))).....))))}.,))))....)))))))......))))))))))........(((.(((((..{(((((.(((((.((....((((..(((((.(((.(((((((((((((...........)))))...)))).)))).)))..(({...{{{................}.,,)}}..,})},,..))))).)))),..}}.))))))))))},..)))))))).).)))))).))).,{{({.((((((((,{(((((.(((((((((({.....{((((((..((((.(((((((((.(((.(((((((((....)))))))))((((.(((((,,,((((..{..{(((((..(((...........)))..)))))).....))))....}}}}}}))||{{{|||||,|||}{((((.,.....((((({....))))))(((((((.....(({{{{((((((.((((((((...........((.((((((((((.....((((..((((,.((((.(((((,..(((((((.{{.((((..(((((..(({.((((((((((......)))))))))).{,.((((...(((((......))))).)))),,..}))..)))))..))))})))))))).}))))).)))).(((......,.)))..,))))..)))).....)))))).)))))))))))))).)))))){{{{.|{,,{{..{,..,,,..,,,}),)}))(((.((((((((((((....((((..((((..,,{{{{.....}).))...))))))))..)))))).))))))})){{(({{(((((.({((((((({,..,{{{{({{((((((((({.((({.{{....,||}))){(((,{(((....|||{,}|||...|||,,||{{{{|{(({{((({{,{{(({.{{{{{||.{|{{||{{{..,,..|..{{,.,},,}}.....)))})}}))}})))))}..|||||,,||||,,}}||,,,{{(((((((((((..(({((((((((({,{{((((((({{,,{((((.........}}}}||}||,,.,||{||||,.,,||,{||||{((({{,((,.......,||.,,||||||}}|{{{{,{{{,.,|{||}||{||{{{{{....((({..,,|||,,|,|||||{{|{,||{|{{|||||||,{|||.|{{,((((((((..,,((,,,{{(({(((((({{{{.|,||||,|||||||||..,({((((((,,(,(({.({{{((,(((((({{{{......{{((((.,,((((,{((,,.{{{,.{||.,,,,..{((.((((.{(((((((.{...{{....,{(((.(((((..{,....(((.((((.((.((..{{......)}...)))).)))).))).,{{,(((((.....((.({.((((((...})))))}}})}...))))),,,.{((((...((((((((({..,((((((((({((,(((.{{......}}))).,||.||,..||}},}}}.,|||||||}||||}}}}}..(((((....))))),((((((,,...}}....)))))).,.,},|{|{||||||.{|...,,)).)}}))),}))))..))))).))))).)))}.,,}.)))))))}.)))).))}.........,,..,,((({{((({(((((,(({{{{,,|||,{{{{{|||(((({{{{(((((,{,{{,{,..((((((((((........)))).)))))).......((|({.,||..|||,(((((((((...(((({.{{..,,..{{{,||||...,,{((.(((,....}))).})}.}.))))}}}.{((({,{({......|||,.((({{(((((((...((((((((((({(.....(({{{.....(((((((((((.,({...,,.((.((........)).}},||.....}}}..((((..(((((((...............((.(((((((.....,.))))))).)).((((((,....,......})))}).,,,,,,((((....))))...)))))))....))))..,,,.,,.{(((((.....,,,)))))).,),.,,)))))))))))}}))}(((((((......)).))))}..........{(,(((.(((((((((..{(((((((((((((,,.,,,|}...(((.{((((...(((((....)))))...))))}.))).,{{..(((((.({....)).)))))....,,,)))))))}}}))))}..))))))))).))).))...},.))))))))))..)))))))))))((((((((((((((...(((((((...(((((((((((((((.{((.(((((....)))))........(((((.(((.(((({..,......,,,,,,,,,,{{{{(({{{,,{((..(((((.((((...............)))).))).))..)))}....,,,{{{(((.((((((......)))))).)))),|{{{.......))}}...(((((((.........)))))))..,))),})))))}..{{{{{.{{,,,....,.,)).})})}.{(((((((((...(((.,{{(({.,....((((...}}}}..,.},,,}.}))}})))....))))).))))}...................))))).))).))))).....,|,.....))).)))))))))))))))...))))))),))))))))))}}),...(((({.(((.(((({(((((.((((.((,((({...((..((((.((((......)))).)))),,,)))),),)))).))))}||.{((((..(((((.......)))))..))))).,.....((((......)))).}))).))).})))).,,,,,.,...........,,})))).))))))))}........,,..,,,,.,}}}}}}}}}......,...|||||,},||||{..,,},,})))))}})}))))}.)))),||.,|||||..,})))))}}|}}||||,.......||||.....}}})))))))}),..))))))}.,,},,,{{{..{{{{|{{{{{|||||||||{|||||,||,.||{||}|{{|}|}||,{{{{{(({{(({,...,}})})},....{(((((((((((.((((....(((((.((({{{,....,,}...))).))))).((.....))..........{{{{.(({...{(({,...,})}}.)}}.}}},.....((((((((..(((((.((.((((((((.....((((((...((((...(((((((((((.((..........,....)).))))).))).))).))))..)))))).))))))))...{((((((.((((....))))..))))))}...)).))))).....))))))))...{((((((((..((.....(((((((((..(((((..................{(((.(((((((((.,...................(((((((((....)))))))))....{((((({.....{((.(({.....))}.))))))))).))))))))))))}.......(((....)))..............)))))))))))))).....))..))))))))}.((((.((((((.((((,.{{....,},.)))).)))))))))).)))).)))))))))))},,((,,((({(((((.......|||}||||||,.}}........((..(((((....)))))..)).(((((((((..((((..,(({({{(....,||}}|...........{{{(((({(....}}})))))}.....,,,,{{||..,.......}))}..|{{{,{(((.........))))}}},)},,,)))).,|||||||||,..,}}|||........}}})))))))}}..|}|,,..||}}}}..}}}.}|}}}|}}}}..,,......((((((((((....((((((.(..((((({...}))))).,),}),})))..))))))).))),,,,,.|||......||.,,}}}}}.},)}}))))))))}}(((((((((...)))))))))...(((((((.((.........)).)))))))...,....,.}}||,||||}}}}.....||||||,.,||{{{.{{{(({(({.....,,.....|||||,,..(({,,{(({{,..,,...,}..))))))})}.....(((((((.........)))))))..........}}},..})))}},}.}}})),}})})},},,}}}|,.}}}}}}},)})},,,,}||,||||...,,,...},,)))))}))}.},}||{||{,,,||.||}}}})),}),,.}}}}))}}}||||,}}}}...,)),}))))))}}}}.....,.((((((((...((((((.(((({{{(((((((((((((....)))).,.{((((..,....,,.,)))}}.........(((((((...((((((.....{,...,}.....))))))...)},}))))((((....)))).(({(((((((.((.((((((((...........))))},))).))..)))))))))...............))))).)))))))))),))))))..)))))))).,,|,||||||||||||}}|((({,{,((((({{((,(((((,..((({,({{{(({((({{{,({{((((((({{,,.,,,,,,.....(((((((((((.....)))))))))))..,,,.{((,,.,|}|||||,|,{{,|||,||||}}}},,..,||,,,..,,,.(((((((((((((((...))))).....))))))))))....||},,,,}||..,,..,{{{,,.,,,,||}|.,,,,,,||,||{|..,,)||}|||||}|||,,{..(((((((....))))))).}}||||{{|||||||,,.{{|||,|{{|||..|)))|,,|||||,,,.||||}}.,,,{{{|||||||,,,,,}}}}.{|||||{{((((,,{{,(((,{,,,,,{{||,|||{,{({{((((((........)))))))}}.,..((.(((((((((((((((.((({{((((,,.((((((...))))))...}|||,.}}}}}...,,||||,,,.,({.,.{{,,{{{{{.{{,,,,|||,,{{{||,..............,{{,|,,},||{,....,,||.,..,}))|((((((((((.....,..((((((....)))))),{{,,,((((.((((((.((((((((...((((((.(((((((((,,,}}||},|||}....((((((.((((((((......))))},))),((({{(({{{{({.((((((((({({(,(((,,(((((((((((((,(((,{{{{|,,,}}}}}},.....{{{.{{......||,,||.........,,..............,,,....{(((((.,((,..,,.,,..,.((((((((((.(((((((((...............))))))))).))))))))))..})})}.,}}}}},,,)))))),.{{{{...{{(({,..,))}}.,...))))...))).)))))).))))}}},)))),,.)))))))))).},...((((((((((((..{{.((....((((((((((((..(((((((..(((((((..(((((.((((((.{((....{{{...,,,,....,|}},..{{{.,,|}||..(((((..,,,.,.((((((..(((((.........}}}}}....}))))),,.,,,...))))).)))...))}.)))))).)))))..))))))))))))))....(((...((((((((.,,.((,({.{{({|,......(({({,,,({((({.{,{{,..((({,...}}}}}.{||{{{{.{|||{{..(((((((((....))))))))).....,,.,,}}.}}}}}}}...|,..((((,,(((((..(((...(((((((.,,,.,,........{((((.,{(((((((.(((((((.((((((..{,.((((((.(((,.,{(((((((((((..({(((((((((.,,,((((,......((((....,))),....||||....}}}}.....,||,{{{{{{{{{{.}||||....,,,,,,{{{.....,,,.,.,},}.}})))}}}}}||.,(((((((......)))))))|{{{{{(((((((.....(((((({...{{{{,|{{{{{..,,{{..,,,,,)|||(({...,|||,|,,,,,,,.||}}},))}))))}))),.}},)}}}},,,,.........,,)),))))))),.)))))))))).)))))))),...}))})))).))))))..}......))))))...))))))).(({{(((({......{{{{{{,...,.,(({{...,..{(((((({,.,(((((((......)))))}}....,,,,.|...,||((,,....))).,..,,,))))))))))),))}))))))),)))))}..))))))))))).))))),,||.{{{.|||,.......}}).})}....))))))).)))..)))))))))){{{((({,..(((((((((((........))))))||)))),,.,,............,{{{.(((((.......((((.(((((((((((((.(((((((((..(.....)..))))))),,|,.........},.))))))))).))))..))))...,,,{{.(((((((((((..,,....|||,.,,{..}})),((((((((..((((((..(((.........)))..)))))).)))))))).............,....(((((((((.,,.....}}.}))))))))))))}})))))).}),........{(((((((((((..,......,..)))))..))))))})))))..}))}))))}}..|{{{.,,},|||||}}|,}|}{((((..((((((((((...))))){((((((...(((((((((........((((((....)))))){((((((((......,,{{,...((((......)))).,..,.,{|..,{,,,...,{{{,...,,))}}},{,{.((((((.........)))))).},},...||,(({{..,,))}},,....(((((((((.(((((((((((,((((((((((....))))))..{(({{...,,.....|||||...,|}}}...(((((.(((((((((....))))))))).)))))......,||{{.{{|,,,...}}))}}}.})))).)))))).))))))))).})))))))},.{{(((,{((((({...))))))),))))).}............))))))))).)))))))..)))))})))}.,....,|||,,{{{,...))))}},,,}}})}......))))),)),})},)))))))...)))...{{((((((...)))))).}|....{{,...))).....))))))))))))..))..{(((((((..((,(((({....})))).))..))},))))).((((.....))))...............(((((((((((.(((((....))))}.((((((....))))))......))))))))))),.{{{,.,,{|||||{{{({{{,,,|||{..,,,,))}},,.}}}}))..)))))))).)))).......}}||||||((((((...........((((.......))))...........))))),...||||}}|(({,,,,,,..{||||||.,,,...{{{......))}...,}}..)))))))..,}}.}))))))))},,......,{,,.....,||},(((((,.,((((.....))))))))))..,,,)))))).........,,........,,,|||||,....}}))}{{{{..,,,,{,((,{{{.(((...(((((....)))))..))),)))))),}..})))..))))))))))))))...)))))))))).,}}..{{{{{{(((((((((,{,{{{.||,,..}}.}}}...}))))))}).,,,((((((((((......)))))))))))}}}}}}.....))))))))))}((((({.{{|................}}}}))))),|,.}||}},,,...,}.....}))))}))))}}}))))))))))).....)}}}}.}))))}}.}},,..,,.((((((.,,..(((((...((((((((................)))))))).)))))..},.)))))),}.,,|||||||}}.,|,|||||,,,,}}}|||},..,,,,}}}))),))})))}),,.})))))))))|||||,}||,,,,},..))..}})))))},,,,|||||,,}))((((((....)))))).}}}},}.}))))}}))}}}....,}))},,}}}}|}}||||,{(((((((((...)))))))))}...{((,({.....)).)))))))))}}.{|||||||||||||..{{{{{{{{{||,|,,((((((((((((((((((((((((((((...,{(.(((.(((.((((((((((((((((((((((((((((.((((((((.....)))}....))))...)))).))))).((((((.,,{,{.....{{{{||},,.......}}}}}}((((..((....))..))))..(((({{......,)),,..}}},.....))))))..........)))))}}})))((((((.,.{{.((.,,...(({{...}}}),..}}}}))..))))))))))))))).))).}}))),...)))))).(((((({(((({.(,,.,{{|||{{|,,,|{{{{.{(((((,..,,..,,}}.))))}|{{{(,,,,,..,|||}|((((...))))}}))))..})))}))}}}.}}|||,,}.,,,})))))......,,,,.............))))))))))))))))))))))..,..,,,..,,,,,,|{{{{((({(.{.((((({....}))))}..)))))))))),||||||||{...))}}.}))))|||||,}}})}|,,,,,{{{{||.,,,||||||{,...{..{{({(,.((........}),..}}}}}..),,.})))))).}}}))}),}||||||||}}}}}}}||{{{..,{||,..,,}}},,)))))},}))))..,}})))))))))))}}}}}|}}}}}.}},((((((((|.((({.........},},.}}}...)))))))}((((((((...(((((..((((((.........(((((((((..((......))..)))))))))))))))..)))))...((((.........)))))))))))).,,,)))}.,.,,))))).,,,)))).)))))))))}.}))))}}.,,,.))))))).(((((((((((({...........).)))))))))))).,.(((...(((((....)))))....))).,,)}}}}.))).})))))))).))))..))))))|((((..({.,.(((...,....((((((...{((........))}..)))))).......})).,.}}.)))),.........}))))....)))))).)))))},...)))))))}..},|}},..((((((........))))))..}},..||{{........))}}.........

Transcripts

ID Sequence Length GC content
CACGCGCGCCCGGCUGGGGGAUCUCCUCCGCGUGCCCGAAAGGGGGAUA… 11893 nt 0.3885
ACAGUCCGGCCCAGAGCGCCAAGCGCACACACCGAGCACACUCCCACAC… 12097 nt 0.3956
Summary

This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008] CIViC Summary for ERBB4 Gene ErbB4 (HER4) is one of the four members in the EGFR subfamily of receptor tyrosine kinases. Ligands include EGF, epiregulin, betacellulin and the neuregulins (Sundvall et. al.). Of these, NRG3 and NRG4 exclusively bind HER4 (Hynes et. al.). Mutations in ERBB4 have been identified in various cancer types including melanoma, lung adenocarcinoma and medulloblastoma. A therapeutic value of these aberrations still remains unknown (Arteaga et. al.).

Forensic Context

A study in mice demonstrated that burn injury to the hind paw induced transcriptomic remodeling in the primary somatosensory cortex, where the ERBB4 gene, associated with axon guidance and MAPK signaling, was identified as one of the downregulated genes [Erdei et al. DOI:10.3390/ijms26083538].