Basic Information

Symbol
ERCC4
RNA class
mRNA
Alias
ERCC Excision Repair 4, Endonuclease Catalytic Subunit FANCQ RAD1 XPF Excision Repair Cross-Complementing Rodent Repair Deficiency, Complementation Group 4 Xeroderma Pigmentosum Group F-Complementing Protein Xeroderma Pigmentosum, Complementation Group F Excision Repair Cross-Complementation Group 4 DNA Repair Protein Complementing XP-F Cells DNA Excision Repair Protein ERCC-4 DNA Repair Endonuclease XPF ERCC11 Excision-Repair, Complementing Defective, In Chinese Hamster EC 3.1.-.- XFEPS
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Other applications

MANE select

Transcript ID
NM_005236.3
Sequence length
6764.0 nt
GC content
0.3995

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1915.50 kcal/mol
Thermodynamic ensemble
Free energy: -2045.23 kcal/mol
Frequency: 0.0000
Diversity: 1695.71
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((......((.((((.((((((((......))).))))).)))).))((.(((((((...(((.(..((..((.(((((..((((((((..(((.(((((((......)).))))))))..)))).)))).))))).)).))..).))).))))))).)).(((((......(((.(((.(.((((((((.......))).)))))).)))))).(((((((((((.((((..((((.......((((..((((((..(((.(..((((((.........(((..(((.......))).)))...)))))).).))).))))))..))))((.(((((((...))))))).))...)))))))).)))))))))))................((((.(((((((((((((((....((((.((((((.((((((((((((((((((.(((((.(((.((((((....)))).........((((((...))))))(((((((((((.(((((..(....)..)).)))..))))).))))))..((((((((.....(((((....))))).........((((((...((((((.(((((((((...........(((...((((.......(..(((((((((((....)))))))))))..).....))))..))).....))))))))).(((((((.........)))))))..)))))).....))))))...)))))))))).))).)))))............))))))...((....))))))))))))))....))..))))))))....)))))).))))))....))))))).((((((....))))))(((((((((((..((((((......(((((..((((((((.(((.((((((((((((.(((((((..((((.(((((.(((((((((((..........))))))))..))).)))))(((((..(((....))).)))))..(((((.((........)))))))....(((((((((((((.((((((........................)))))).........((((((((((((((((.((........((((.....))))................((((((((...(((((((........(((((((((((...........((((((((((((((((((((..(((((((.((((......))))......))))).....))..))..)))))))).))...)))))))).....((((.(((((((((((((((((((...((((.((((.(((..((((((((.(((((((((((..((((.(((..(((((((((.........((((((((.(((((...(((......))))))))..................((((((((((((((..........((...............)).(((((....)))))....)))))))).....(((((....(((((((((.((((((((((..(..(((.(((.((..(((((((((((((((.......)))))..(((((........((((((((((((((((.........))))))))....(((((((....)))))))......((((((((.....((((((((.((((((...))))))...((((((....))))))......)))))))).....)))).)))).)))))))).((((((((......((((((..(((.((((......((((.(.....).))))..((((((....))))))((((((........)))))))))))))..))))))............))))))))((.((((((((..(((......(((((((....(((.......(((((((...((.((......)).)).((((((((((..((..(((.......))).((((((..((((((....))))))..((((((.((((.....((..(((((((.........)))).))).))...(((((........)))))....(((((..((((((((((.((((((((....(((.((((.((.......))..)))))))..)))))))).))))........))))))...)))))((((.....))))..)))).))))))........((((.((.....)).)))))))))).......)).))))))..)))).((((......))))..))))))))))...)))))))......)))...))))).))).)).))))).....)).))))))))..))))).)))..)..)))))))...)))....)).)))))))....))))).(((((((((.(((.((((((.(((((......((((((.(((((......))))).))))))(((.......)))..((....))..((.((((((.......((((..((((....(((((.(((....)))..)))))............(((((((......(((.....)))......)))))))))))..)))).....))))))))(((((((.....)))))))..))))).))))))...(((..((((....)))).))).....))).))))))))).((((...........))))..(((((((((..................)))))))))............((((..(((.(((((((....))))))).))).))))..)))))).((((((((.((((((((...(((((.....((((((((((((.((((((...................))))))...))))))))...((((((((((((((((((((((.(((..(((.......)))..))).))).))....(((.(.(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((.((((((((((((((((.((((...((....))....)))).)))))))))))))))).))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))).).)))............((((..(.((......(((((((..................)))))))......)).)..)))))))).......))))))))..))))).((((((...))))))..((((((((.(((.....))).)))).)))).))))...)))))...))))))))..........)))))))).....)))))))))).)))))))....)))..))))......))))))))))).........)).)))))).))).))))...)))).))))))))......((((((((.(((((((((.((.........))..)))).))))).((((((.......(((((...))))).........)))))).....))))))))........(((((..(......)..)))))......)))))).)))))..))))......))))))))))).......)))))))........((((((.......((.((((((((((((.....((((((....))))))((((((((((..(((((((.....))))).....))..........((((((((((((...((((((((((((((((((((.((.(((((((((.((.(((((((((((((((.(((((((((((((......(((((((((.(((((..((........(((((....((....(((.(((((((......((((((((...))))))))............))))))).)))....)).((((.....))))......))))).......))..)))))...((((........))))(((((((.(((((((((((.(((((((((((((((...((((((......(((((((...((((((((((.((((((((..........((((((...........((..((((.......))))..))...))))))..........))))))))..))))))))))...)))))))............((((((..(((((((.....))))))).((((((........))))))..(((((((((......))))))))))))))).........)))))).)))))))))..))))....)).))))))))))))))))))..((((......(((((((.................)))))))))))...((((((........)))))))))))))))))))))))))))).))))))))))))))).)).))))))))).)).)))))))))))))))..........((((((((...(((.......(((((.....(((((......)))))....)))))))).......))))))))))))).)))))))))))).))))))))))..........))))))).))))).))....)).))))....(((((.......)))))..))))))))((((((((((......(((....)))...(((((((..........(((((((.(((((((.(((((...((..(((((.(((((...((((((......(((((((((..((((.(((.(((...(((.(((((.....))))).))))))..))).))))..))))))))).(((((...)))))((((.......)))))))))))))))))).))..))....))))).)).........))))).)))))))..........)))).)))...........(((((.......((((...(((((((((((((((((((..(((((((...((.........))...)))))))..(((((((((.........))))))))).(((((((.........................((((((....)))))).(((((((((((..((((..(((..(((((((..((((..(((((((((((((((...(((((.(((((((((...((..((........)).))...))))))))).))))).......((((.....((((((((...(((((((((......((((((............(((....)))............)))))).....(((((((.((........)).)))))))...........(((((......))))).......((...(((((((((..(((.(((((((((.(((((((((((((((((((((.....)))))).(((((((((.(((((((.....))))))).((((((..((......)))))))).(((((..(((.....)))..)))))....((((((..((..((((((((....))))))))...)).)))))).......))))))))).))))))))))).(((((((....((((((...)))))).)))))))..(((((((((......)))))))))....)))).)))......((((.(((..(((((..(((((((((((.....(((((((((((..((...((((.((.....)).))))...))......((((((((.((..(((....)))..)).))))))))................(((((.....))))).))))))))))).....(((((((((.(((..((((((((((((...)))))))..)))))..)))...))))).)))).)))))))))))..)))))))))))).(((((((((((........((((((....))..)))))))))))))))......((.((((.(((((((((...))))))).)).)))).))((((((((((...(((((((.((.....)).)))))))..((((....))))..........)))))))))))))))).)))..)))))))))..))..)))))))))....))))))))......)))).....))))))))...))))).))..))))......))))))))))..))))..)))))))))))(((((....(((((((((..((.(((((((...((.(((((((...................))))))).))....)))))))..))..)))...))))))(((((((((((((..(((.(((...))).)))..)))))))))).)))...............)))))))))))).((((....))))............))))))))))))))))))).)))).....)))))(((((....)))))))))))))))..)).))))).......(((((......))))).(((.((...)).)))..))))))))))).)))))).))))))).......))))))))))).)))...(((((...(((((.(((((((((((......)))))..........)))))).)))))....)))))(((((.((((........)))).))))).......))))).)))).))).)))).)))).....))))))))))).))).))))))))((((((...))))))..((((((((((...)))))...))))))))))....)))))))........
Thermodynamic Ensemble Prediction
.(((((((......((.((((.((((((((......))).))))).}))).))(({((((((({{{,(({,..,|}},|}|||{,..((((((({..{{{.|||||,}|||,,,,),)))}}}}),,}}}},)}||.}|||}|}},}}..}.|||.|||||||,|,.{{({{...,||{({.(((,(.((((((({.......})||)|||}}.}}||||.(((((((((((.((({..{{{{...,,.{((((..((((((.,({(.{..((((({....,,...{{{..(((.......))).}}}.}}}))))).}.})).))))))..}}}}((.(((((({...))))))).)).,,))))}))).))))))))))),|}}.{{{{,,..,..((((.((((((((({(((((.,..((({,{{{{{{.(((((((((((({((({{.,((({|{({.,{{{{(,,.,))}}.,,.....,{{(({{...|}|||{((((((((({{.{{|{{.,{,...|,,||.|||,,||}||,|}}}|||,(({{{{{{.,...|||||,,,,))})),,},,,,,,{(((((...((((((.(((((((((...........{{{...((((.......{..(((((((((((....)))))))))))..,.....))}},,))}....,))))))))).{((((((.,.....|.))))))}..)))))).....)))))}...}}}}}}}}},.)))}|||}}...,}},},}}.,}))))...||,,..}}))))))))))))..,,}}..}})))))),...))))))}})))))},..))})))).||,{({|||.|,,}|{(((((((((((,.((((((......(((((.{({{{{{{{.{((,{{{({{(({({{.{{{{{{{..{{{{.(((((.(((((((((((..........))))))))..))).)))))|{{||,,||{...,))).)))))..{((((.((........)))))))...,((({{{{((((({.(({{({,.......................})))))......,,,{{{{{{{{{{{{((({|{{........((((.....)))}....,,,..,,,,...((((((((...(((((((,(({....(((((((((({...........((((((((((((((((((((..,,(((((.{(((,.....}}}}.,,}}.))))).....,}..}),.}))))))).))...)))))))){{{{{{{,,,({{(((({{{(((((((((...((({.((({.(((..((((((((.((((((((((({,(((,.,...|{{|{{.,{(,,....,|||...{{||.{({((...{{{......}}}))))},....,,,............(({.((((,,,,..,..,},,,}}||.....,........,.,|||{....}}}}},...|||||||,...,,,{,{(((((((.,,((((((((((((((((.((......)).))),.......,({((.,,((((((,(((((((,{,,{,..,,,{(((((({((((((((({,,,...}.,))))}}}}.,,.{{{((((....))))|||,,,,...{((((((.....((((((((.((((((...))))))...((((((....))))))......)))))))).....)))).)))))))))),,}..((,((({....,,,})))),))|)))|||..,,,.{,||}|{(((((((((,(({....})}.,)))))))))}{|{{,,,,..((((({{{..((({,,{((((.((.(((((.((((...))))....,{{{(,,,,}}}}|{,.....}},..(((((..((.((....}).)).))))),,,({.(((((((((......,...((((((((,.....,,.(((((((({(((((....)))))}..{,{{(,(((,(((....))))}}{{{{,........}}}}.{{{{((........}}}))}..}||||{|,.(((((,.((((((,{(({((((((((....(((.((((.({.......))..)))))))..)))))))),))))........)))))).,.))))),{(({{{{,|}|||,||||.|,,|||.......{{{{|,||.....,}.}}}}}......,.}},.}}}}.,}},}}))}..((((......))))....))))))))..)))))))))..........))))}})))).)}.)))),.))))))).)))))))))..)))))))......{{{{{{{{{{{...........,,,,....,,.....,{{(((((.....|,...|}})),|.....{((((((.(((((......))))).))))))|{{.......}}|{{((..(({{..{{||,|{{({(((({..(((({...{,{{,{,,,|}|,.....,,,..|{{{((((({.{...{{((((((({{{{{.((({{{{{|{|.....,|,|||{({(|..{||.,....((((.,.,.(((((((.....)))))))..,...))))..,,.}}|||}}}|{|,...)))),),,...}})},.}})))))},.((((.....,.....}}))..{((((((((...,,..........,..))))))))}.....{{{....((((..(((.(((((((....))))))).))).))))..,)))|}...,|,||},(((,,,,,}}},{{({,,...{(((({((.,,,.((((((...,...............))))))...,))))))}},.,,|||}||||||,,|}}})))}}.}))))))},})).||,|,.{((({.,....,,...))))|((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((.((((((((((((((((.((((...((....))....)))).)))))))))))))))).))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))}.({.(({{{{......{{((({...,})))}...(((((((..,,..........,,,.))))))).........,..,,)))))).}}....,,)))))..})))))}|||||,}}})},,))}})||}}}}}))}}}})}}))),,}}}.}}}}}}},|{{{||,,..}})))))))|}})}))...}})},,,,,..,)))))))),.,,.}))))..))))))))}})}})))...})))))))))).........))}}))))).))).})))...)))).))))))))}.....,,{{{{{,.{((((((((.((.........))..)))).))))}.,{{{{{.......,{,((({{.,,,,.}}}},...}}}}}|,,,,.,||||}}|,{{{{...(((((..(......)..))))),}}},,,}}))),}}})),))}))......}))))))))))....})))))))))........{((({{.......((.(((((((((((,...,.((((({....})))))((((((((((..({(((((.....))))).....}}..........((((((((((((...,,{{{(((((((((((((((.((.(((((((((.((.(((((((((((((((.(((((((((((((......,,{{{((({,(((({{{{{,,{,......(({,,...||.,|||{.{{{{{{|.,,,..((((((((...))))))))............}})||||.||{{{{..|,((.....{{||,,.}}}}..)))}.....}}))}}...)),,.{{{{,,,.....})))(((((({{(((((((((((.(((((((((((((((.,,((({{{.,....(((((((...((((((((((.((((((((..........{{{{{{..,,.,,,...||,||,,{..,,,,.,,}}},},...}))))}..........))))))))..))))))))))...)))))))............||(((({.,{{{(({.....}))}}}},((((((........))))),,,(((((((((......)))))))))},,)))},.......}})))),)))))))))..))))....)).))))))))))))))))))..,{{{......(((((((............,,...})))))),,,,...{{((({........)))))))))))))))))))))))))))).))))))))))))))).)).))))))))).)).)))))))))))))))..........((((((({...,..{,.....{{{((.,,..{({{{....,,))))}....}||||.}.,,,,},.))))))))}}}}}.)))))))))))).))))))))))........,,)))))))}})))).))....}}.))))...,(((((.......))))).})))))))){{(((((({{....,.(({.,,.||}...}},|,,,.{{,...{{{{{({{{{{{..,.{{.(((({,,,((,,((((({(((((...((((((,.....(((((((((..((((.(((.(((...{({.(((((.....))))).})))))..))).))))..))))))))).{((({...})))}{(((.......))))))))))))))))))}),..}}....}}}}}.}}..}}}}}},||||}}.,|.}}}........}})})},)))},,}}}}}}}}|{(({.......((({...(((((((((((((((((((..(((((((.{,{,.,{......))}}})))))))..,((((((((.........))))))))|.{((((((..........,,.............,{((((,...,})))),{((((((((((..((((..{((..(((((((,{(({{,,(,(((((((({{{{,...(((((.(((((((((...((..((........)).))...))))))))).))))).......((((.....((((((((...(((((((((......((((((............(((....)))............)))))).....{((((((.((........)).))))))}...........(((((......))))).......((...(((((((((..(((.(((((((((.(((((((((((((((((((((.....)))))).(((((((((,((({{((.....}}}},||,{(((((..,{......)})))))|.(((((..(((.....)))..))))).,..((((((..,,..((((((((....))))))))...},.)))))),,..,}}))))))))).)))))))))}}.(((((((.....((({....}))}}}.)))))))..(((((((((......))))))))).,,.)))).))),.....{(((.{{{,.{((((..(((((((((((.....{((((((((({..,,...{(({.{{.....|},}}}}...|}.....,((((((((.{(,.({{....,}}..)),)))))))}.,,.............(((((,...,))))).))))))))))}.....((({((({{,(((..(({{{{(((({|...))))))}..)))))..}))...})))}.}}}}.)))))))))))..)))))})})))}.(((((((((((........(({{((....))..)))})))))))))))......((.((((.({(((((({...})))))).)).)))).))((((((((((....((({.,.,|}},.,||{|||||||....}}}}}},.,)}}}.......))))))))))}))))).)))..)))))))))..))..)))))))))....))))))))......)))).....,}}))),},})),))),),.,)))}......)))))))}))..))))..))))))))))}((((|{{,.({(((((((..((.(((((((...((.(((((({.,....,,....,,,....))))))).))....)))))))..}}..}}}...))))))(((((((((((((..(((.(({...,}}.)))..)))))))))).))).............}})))))))))))).((((....))))............})))))))))))))))))).}))}.....}}}})}||}|||,||||,.,))))}))),..}}.,}}}........((({{..,,,.))))).,,,,(({{{||.||||||}|}}}}}}}}.}}}}}}.}}}}}}|......,))}}}}}}}}}.}})|,,{{{{{,,,{{{{{,{{{,|,{{{{|,,,,..},,||{{{{{{{{....))))))))))..,,,}},{(((((.((((........)))).)))))).,,,,,)))}},)))),))}.}))),.}))}}}.,))))))))))).}})}}}}}))))}|{{{{...))}}}|{((((((((((({{{.....)}})}))))))))}},.)))))))........

Transcripts

ID Sequence Length GC content
GGAAGAGCUUCCAUGGAGUCAGGGCAGCCGGCUCGACGGAUUGCCAUGG… 6764 nt 0.3995
Summary

The protein encoded by this gene forms a complex with ERCC1 and is involved in the 5' incision made during nucleotide excision repair. This complex is a structure specific DNA repair endonuclease that interacts with EME1. Defects in this gene are a cause of xeroderma pigmentosum complementation group F (XP-F), or xeroderma pigmentosum VI (XP6).[provided by RefSeq, Mar 2009]

Forensic Context

A study in mice demonstrated that ionizing radiation induced a 0.39-fold down-regulation of the ERCC4 mRNA in bone marrow cells, implicating it in the DNA damage response [Dai et al. DOI:10.1080/09553000600857389]. In humans, research on healthy Han Chinese individuals established that the mRNA expression of the ERCC4 in peripheral blood mononuclear cells declines in an age-dependent manner (r = -0.844), providing a quadratic mathematical model (Y = 0.0003x^2 - 0.0459x + 2.0439, R^2 = 0.729) for forensic age estimation [Deng et al. DOI:10.1016/j.jflm.2017.05.005].