Basic Information

Symbol
EREG
RNA class
mRNA
Alias
Epiregulin ER Proepiregulin EPR Ep
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Wound age identification

MANE select

Transcript ID
NM_001432.3
Sequence length
4615.0 nt
GC content
0.3610

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1200.20 kcal/mol
Thermodynamic ensemble
Free energy: -1292.62 kcal/mol
Frequency: 0.0000
Diversity: 1033.78
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((....((((...(((((((((.(((((((((((((((((....(((((.((((...))))((((.(..((....)).).))))..(((((.....((((((((.(.((((.....(((.(((.(((((.((..((....))..((((...((((...))))...)))))).))))).)))...)))...))))))))))))).....(((((..(((((.((((((...........((((((.((((..((((...)))).))))))....)))).))))))))))).)))))..(((((........)))))))))))))))....))))))).)))))...)))))....(((...)))..))))))))))))))))..(((..((((((..((((((((.....((((((((...(((....)))......(((..((((((..(((((.(((...))).))))).))))))......)))))))))))........(((((((((((((((((.((((.(((((...................))))).))))..))..)))))))))..........(((((((((..........................((((((((((((((..(((((((((((((.((((.(((...))).))))..((((.(((.((......(((.((((.(((....))).)))).))).((((((((.........)))))))).......)).)))))))(((((((......)))))))((((......)))).....((((((((((...((((((........)))))).....(((..((.....))..)))))))))))))((((((((.......))))))))............)))))))))).....((((..((((((((((....))))).(((((((((.(.....((((((....))))))...)))))).))))(((..((((((((((.....))))))..))))...)))((((....)))).....)))))..)))).)))..))))))))))))))(((((((((....))))))))).))))))))).((((((((...(((((((((..(((.((((((((((...........((((..((.((((((((((......((((((.(.(((((........)))))(((((((((.((((..(((((((((........)))....))))))(((((..((((((...)))))))))))((((((((...(((((.(((((...((((..(((((((((((..(((((...((((((..(((.....((((.(((((((.(((..(((((....)))))............(((((((.((((((.((((...((((((((((((........((((...))))))))...))))))))....((((.((....))))))..))))...)))))))))))))..(((((..(((.(((...))).)))..))))).....))).))))))).))))....)))..................(((((........((((((.(((((..((((((....(((...(((((((((........)))))))))...))))))))).))))).))))))......((((((((((....))))).((((((((.((((.(((((((...(......)..))))))).))))...)))))))))))))((((((((.((((((((.((.................)).))))))))..(((......))).....(((.(((((.....))))).))).........))))))))..)))))))))))..)))))..........)))).................((((((((......))))))))((.(((((((((....)).))))))).))...))))))).....)))).....))))).)))))..)))))))).(((....))).......(((((((((.....(((((.(.....).)))))...))))))))).(((((((.....(((((((((((((........)))))).(((((((((((((....)))))))))))))..(((.......)))....)))))))...(((..(((((.((((((((((.....(((((((.....(((((((.......)))))))...)))))..)).......)))))))))))))))..)))........(((((((..(((((.......((((((((((...(((((((((((((((((((((......))))))).....)))))))))..))))).....((..((((((....(((((((((((((((.((((((((((((((...............(((((((((((((((...(((((((..((((((......))))))...))))))).((((((((((.....(((.(((((.....))))).)))....)))).)))))).((.(((.(((((.(((((((....)))))....)).))))).))).)).........................................................)))))))))))))))..((((((...))))))((((...((((.((..(((((((((((((.((....)))).)))))))..))).)..)).))))...))))(((((((((.(((((....))))).(((((((......(((....)))......))))))).....(((((.(((((((((.((.(((((.......(((.((..(((.(((((((((..........)))))).))).)))))))))))))))...))))))))).)))))(((((......)))))......(((((((((...........)))))))))...............))))))))))))))).)))))...))))))))))..............)))))).))....)))))).)).(((((.((((.(((((((((..(((......)))..))))))))).)))).))))).....))))))))))....(((((.....)))))....)))))..))))))).))))))))))))))))))))......((((((....)))))).((((((((.......................(((((..(((((((((............))))).))))..))))).(((((.....(((((.(((((..((.((((((((..(((((((((.((((((.((((....))))......((((.....)))).....(((.....((((((.........))))))....)))....)))))).)))))))))....)))))))).)).))))).)))))....)))))(((((((((.......)).))))))).))))))))..).)))))).((((((((.(((((..(((....))).))))).....((((.(((((.((((..............)))).))))))))).(((((((.....(((((((...................)))))))..))))))).....(((((((.....)))))))..(((((.((..(((((........)))))..))..))))).(((..(((..(((((.((((..(((((..((((..(((((.....)))))..))))..))))).))))))))))))..))).(((((......)))))..)))))))))))))))))).))..))))..........((((.((((((.....((((..((...(((((....((((.(((....(((((((...((((((........))))))))))))).....)))))))..)))))...))..))))))))))..))))..)))))))))).)))))))).))))..))))))))((((..(((((((((....))).))))))))))....)))))).....(((((((..............((((((((.....))))))))....(((((((..((........))..)))))))...(((((.(((.....))).)))))))))))).....((((((..(((.....))).))))))((((((.....)))))).(((((((...............)))))))....(((((((((((...(((((....((.((((((((((((....((((.........))))(((((((....))))))).......((((.(((((...((((((((.((.(((.(((((((((.....((((.(((((((((..(((((.((...((((.......))))...))))))))))))))))))))...))))))))).))).)).))))))))))))).))))...........)))))))))))).))...))))).))))))))))).(((((((((((((.....................)))))))))))))))))))))..))...))))..)))..
Thermodynamic Ensemble Prediction
..,(({((((((({...,))))))),,.(((((((((((((((((....(((((.(((({..|||,((({.,{}||....},.|.{{|{......)))}..((((((((,(.(((({{{{{(,,.((,.(((((,(,..{{....}},|((((...((((...))))...)))))),)),)).)))}}},},...))))}))))))))...,{,((((..(({((,((((((.....,.......}}||}||{{..||{{...}}}|,|||},,,,,})),,.}}})))))))).||||,...}|||..,,}}..,})),))),,)))))....))))))).)))))...)))))..,.((((((((...,,,.(((({((((.|.{{(((,{((((((((.(((,....((((((((((...(((((.....(((((.((....)).)))))(((((((((((((((((({{{.,,...,,.......{,||,}||....,{{{.,((({({(((((((((,,.{{{{,(((((,,,,.{,,,.,,,|,,,,,}}}}}.}}}}..||{{|}}}}}}||(((((({.....,,}.}})}))}..,....||...}}}}}.,}}}})|}},}}||||||||}}}.((((((((..{{(((((((,,,..,{{....,})),((((((((.({.((((((((.(({....})).))),.,{{,((({{{{{..,,,,...}}}}}}}}..,,|,|{|{||||...(((((((......)))))))((,{,,{{{{||}}.,,{((({{{.,,,}},,|{((((........))))}}.,(((((((((((((({..,{{|{((({,{{,..((((((({.......)))))))).,|,,....,,,..{((.(((((({...(({{....,.|}}},....,,,....,,((((((.(.....((((((....))))))...)))))),},))))))).))}.{||||,,,,,))}}|{,,|||}|||,{,,|}||||,,}||,|,},,.((((((({((({.(((((({((,((,,.((((((((((....))))))))))..(((((((((({((((.....))))).)))))))))).,,,||,.},,,,,.,,.||{,..,(((((((((.{((.,......(((..((((((,........,,......|,....((((...(((((((((.,....,.))),,,.}}))))....))))....,.,.|||...((((.((((..((.......))..))))..)))).}}}...})))))..)))......,.))}.)))))))))|{{,.|||{{{,.|||,,|||||}}},))),),}.|},,.....{((((((.((((((.((((...((((((((((((,.......,{{,...,}})))))...))))))))....((((,({....)}))))..))))...))))))))))))|{.(((((..(({.{{{...})).)))..))))).}},.,}}.,}})))).))))}))))}))),))),))))}))),.,,.))))).},))))))))......,,.,,,........,....(((((((((........)))))))))((((((((({{{....}})))))))))......(((((((((((({.(((((((((....,{{,.(((((((((((((((({(((,.((((.(((..((.((((((((((((.((((((((.{(((((((.((,.............||,}}.)))))))}..,{{......}}}..,|,(((.(((({.....})))}.))}....,,,..})))))))(((,({.((.,.....}}.}}.))),,}}}}}},...((((((((((((({((((({(,,,,,,,|}}|||||((.(((((((((....)).))))))).)}...,||}||.}}}}}}}((((.,{.....}}.))))..{(((.(({{{,....|}|,,,,...(((((((((.,.,.(((((.{.....,.))))),..))))))))),||},,.....}}(((((((((((((........)))))).(((((((((((((....)))))))))))))..(((.......)))....))))))}.})))))}(((((.((((((((((,....,,(((((.....(((((((.......)))))))...)))))..,}.......)))))))))))))))..||,.}},,,})))))))))))))}.........,........,..(((((((((((((((((((((......))))))).....))))))))}.,)))))..,,{{(..((((((..,.{((((((((((((((.((((((((((((((,,.............(((((((((((((((...(((((((..((((((......))))))...))))))).((((((((((.....({(.(((((.....))))}.}}}....)))).)))))).,({({{.(((((.({(((((....)))))...,)),)))}}.))}.)).........................................................,})))))))))))))}}|(((((...))))),((((...((((,((,.(({((((((((((.((....)))).)))))))..))),),,}}.))))...)))){{(((((((.(((((....))))).(((((((......(((....)))......))))))).....,({((.{{{{{{{|{.{({((((({,{{{{.{({{((..(((.(((((((((..........)))))).))).)))))}}})))||||,..,,,,))))).,))))|||,|}}}}.}))),}....{,(((((((((...........))))))))}.,}}...........))))))))))))))).)))))...)))))))))}.............}))))))),}....)))))).})..,....((((.(((((((((,,(((......))).,))))))))).)))))))))))))))).))..))))))).{||||.....|||||(((({{((({{....}}|||{..,,,}.}}}}.............((((((....)))))).((((((((..................,,,,,,{{{{..{|||||{(({....,.....|||||}.}}||,,|}|||.(((((.,,..(((((.(((((..,{.((((((((..(((((((((.((({{(,(({{...,||||,,,,..,,,.....}))))..,}}|,{....}|||,{|.......,,||||||.....}},,}})))))).)))))))))....)))))))).,}.))))).))))),,,.)))))||||||||,...,,,,)),))))))}.)))))))){{({.,,,,|}}},(.(((((((((..(((....))).)))))...)))),}....},)))},}})))}}....}}}},))))))))))))))))...},,....))))))))}.......,,........{((({....|)))}....,.{((((((.....))))))}..{{{{{.{(,.(((((........)))))..))..}}}}}(((.{{{....))).)}}.(((((...)))))....}))))))))))))...............{(((.((((((.,.......,.}))))))))))))))))...}}.)))))))),}}}})))))))....|||||{|}|,.,,,|,,...}})))))})))))))).)))))))))))))...(((((((...((((((........)))))))))))))...}))))....))))))))))......,.})))))))))))}}}|,}..}.))))..})))){{{{....)))}...((((..(((((({((....})).))))))))))..))))))))..,,.{((((((....,{{.,,,{,.((((((((.....))))))))....{((((((..((........))..))))))}....{{{{,{|,..,,})))})))))))))))}.,,..((((((..(((.....))).)))))),(((((.....})}}}}.(((((((...............)))))))....{((((((((((...(((((.,,.((.((((((((((((...,((((....,,,,.}}},(((((({....)))))))...,{..((((.(((((...((((((((.((.(((.(((((((((.....((((.(((((((((..(((((,(,...((((.......))))..,),))))))))))))))))))...))))))))).))).)).))))))))))))).))))..}},,.....)))))))))))).)).,,))))).))))))))))|,(((((((((((((.................,,..)))))))))))))|||||,,|,......}))),,))}..

Transcripts

ID Sequence Length GC content
ACUUGCCUGAUAUUUCCAGUGUCAGAGGGACACAGCCAACGUGGGGUCC… 4615 nt 0.3610
Summary

This gene encodes a secreted peptide hormone and member of the epidermal growth factor (EGF) family of proteins. The encoded protein is a ligand of the epidermal growth factor receptor (EGFR) and the structurally related erb-b2 receptor tyrosine kinase 4 (ERBB4). The encoded protein may be involved in a wide range of biological processes including inflammation, wound healing, oocyte maturation, and cell proliferation. Additionally, the encoded protein may promote the progression of cancers of various human tissues. [provided by RefSeq, Jul 2015] CIViC Summary for EREG Gene

Forensic Context

A study in humans investigated the EREG as a potential biomarker for gamma-hydroxybutyric acid (GHB) intake via qPCR in blood samples, but alterations in its expression relating to GHB intake could not be confirmed to a forensically sufficient degree, with no significant differences observed between case and control groups [Mehling et al. DOI:10.1007/S00414-017-1609-3]. In a separate human study on skin wound healing, the EREG was identified as an EGF family ligand marker and a paracrine pro-migratory signal predominantly expressed by wound macrophages, specifically Mac1 macrophages, and was noted to show reduced expression in chronic diabetic foot ulcers [Liu et al. DOI:10.1016/j.stem.2024.11.013].