Basic Information

Symbol
ERN1
RNA class
mRNA
Alias
Endoplasmic Reticulum To Nucleus Signaling 1 IRE1 Serine/Threonine-Protein Kinase/Endoribonuclease IRE1 IRE1P Inositol-Requiring Protein 1 Inositol-Requiring Enzyme 1 ER To Nucleus Signalling 1 Ire1-Alpha HIRE1p IRE1a Endoplasmic Reticulum-To-Nucleus Signaling 1 Protein Kinase/Endoribonuclease Inositol-Requiring 1 EC 2.7.11
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001433.5
Sequence length
7895.0 nt
GC content
0.5084

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2689.60 kcal/mol
Thermodynamic ensemble
Free energy: -2838.55 kcal/mol
Frequency: 0.0000
Diversity: 1907.03
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((..((((((...(((.(.((.(((((..((...))))))))).).)))((.((((....)))).))((((((.(((((...((..(((((((.(((((.((((....(((.....)))..((((((((((((((((((((..(((((((((((..(((((((((..((((((..((((((((....((((((....................))))))..))))(((((..((.((((.(((((((.(((((((.(((((((.......((((((((....)))).)))).(((.(((.((......)).)))))).))))))))))))..............)).))))))).)))).)).((((....))))......(((((((((((((((((((....(((((.........)))))..(((((....)))))))))).((((((...((((((............)).))))))))))((.((((.((...((((.....))))...)).)))).)))))))))..)))))))(((((.....))))))))))........((((((.((......))))))))..............))))....)))))))))))).)))..(((((....))))).....(((.(((((((((((((.....((((.((...(((((((((.((((((((..(((.((((((.((((.((.(.....).)).))))))))))..)))....)))))))).))))).))))......))))))....)))).))))......(((...((((((((((((((.((((.((((((((.(((((..(((((.((((.....))))))......((((((........))))))(((((.(.((.((.((.((((((((((.(((.(((..(((..((((((..((((...((((...(((((.......).))))...........))))))))..))))))..)))..))).....))).))))((((((((((...)))))))))).)))))).))..)))).).))))).))))))))))))))))....((((((.((((..((((((..((.....(((((.(((.((((.((((..(((((...(((.((((.((......(((((....)))))......)).)))).)))..(((((...((......)).)))))((((((....))))))(((..(((((.......)))))..))).....))))))))).)))))))))))).(((((((........)))))))((((((.(((((...)))))...)))))).))..))))))...)).)).))))))((((((.((.((......)).))))).)))......((((...))))...((((...(((((((...)).)))))...))))..)))).)).))))))))))))...)))(((((((.........)))))))........)))))..))))))))))))))....((....))((((((....))))))(((.....))).((....))..)))))))))))))))))))).(((((......)))))....(((((.(((((((((((((((((..(((.......)))..)))).))))))((((.......))))..)).)))))....))))).......))))))))))))))))..))(((...((((.((..(((....)))...)).))))...)))..))))).).)))))((((((.((((.(((((..((((....))))..)))))))..(((.((((((...(((((((..((((((((....)))..((((((((((...(.((((((((((((((...((((((((.((((.((.(.((((.........((((.(((((.(((((..((((.((.((((.(((((...(((......))))))))....))))))))))....)))))((((((........))))))...(((((.(((.((((((((..(((...(((((.(((((((.((((...((((..(((.((((..(((((((((.((...((((((((..((((((.(((..(((.......)))..))).............(((...(((((.(((((((..(((.(((((.(((.(((..........(((..((((((......)))))))))......(((((((((.((((((((((((.(((.((.......)).)))...((((((((.(((((((((((.....((((((((((((((((((...(((((.((.(((((((((((...(((((.....)))))...)))))).))))).)).)).)))..........))))))).)))).((((......))))...........((.(((((.(.((((((((((((((((..((((......))))..))))))))......(((....)))((((((((((...............)))..)))))))..(((((.....(.((((((((((...(((.(.(((((....(((.(((((((((((...........)))))))...((((((.((((((((((...(((.(...(.((.(((((..((((((((...(((..((.....(((.((((.(((.(((.((..((((((.((((..((.((((.(.......).))))))))))((((((((((........))))((((....))))...)))))).(((.....)))..(((((((((........(((.((......))..))).((((((....))))))...((.(((((.....))))).))..)))))).))).))))))....)).))).))).)))))))))...)))....))))))))(..(((....)))..)......(((((((..(((((((.(((((((...((.(((((((....((((((..((.(((.(((.....)))))))).))).)))......))))))).((((((((......))).))))).(((((.(((.....(((((((....(((((.((...)).)))))..)))))))..........((.(((((.(((((.......))))).)).)).).)).))).)))))...))..))))))).)))))....((((((((...(((....((((...........))))....)))...))))))))..........(((((((((...((((...((((((.......((((.......))))....))))))....(((...((((........)))).))).))))..))))))))).))..))))))).))))).)).).)))))))))))))).))))))(((..((((((...(((.....)))))))))...))))))).)))..)))))).))).....)))))))).)).)))))).........)))))))).).))))).))(((((....))))).)))).))).)))).)))).))).)))))))))))))))......)))))))))))))).))))))...))))).)))..))))))).)))))..)))((((((.......)))))))))))).....)).)))))).(((((....)).)))(((((((((.....))).))))))(((((((...(((((.(((((......))))).)))))(((.....))))))))))...))))))).))))((((.((((..((.((((.(((.(((.(((((..(((((.((((((((((((.((((.((((....((((((..(((((.......))))).)))).))...))))...(((((((...)))))))...(((.((((...((((..(((.(((...)))))))))).)))).)))...(((..((.(((((.((((((((.((..((((..(((.....)))..)))).)).)))))))).))))).))..))).)))).))))))))))))((((((((((...(((((.((((((...((((((..(((((....((..((((((.(((((........))))).))))))..))........(((((((((......)))))))))..(((((..........))))).......(((((((((.......)))))))))....((((....))))......(((((.....))))).....)))))..))))))))))))..)))))...))))..))))))...............(((((.((((........)))).)))))....((.(((....))).)).(((((....)))))...((((((..((((.(((...(((.((..(((.(((((((((....((((((((.(((.(((((((((((.((.....)).)))))..)).)))).))).((((.((((((((((........)))))))))).))))(((((((..((((((((((....)))))))..))).)))))))...................))).))))).....))))...((((...(((((((....)))))))..))))....))))).)))..)))))....)).).))))..))).))).....((((((....................)))))).......)))))..)))))))).))))))).))))))))))..((((.((((.(((((.((...)).))))).))))))))))))))).))))..)))).))))))))))))....)))..))))).)))..))).)))))....))))))))).(((((...))))).((((((((((.......)))..(((((((((.((((((((((((((((((.(((.((......((((((((..(((((.((.((((((.......((.((((((.((((((((((.....((((....))))(((.(((...))).)))...((((((.(((((.(..((((((.(((((.(((((((((((((....))))).............(((((..(((((((..(((........)))...((((((......(((.....))).....))))))...)))))))..))))))))))))).....))).))..))))))..).))))))))))).(((((.......)))))....)))))))))).)))))).)).............(((((((((((((((..(((((((.((..((((.(((.((((....)))).)))..(((((((((.(((((((......((((.((((.((((......))))......(((((((......)))))))..)))).))))........))))))).).......))))))))...((.(((((.....(((.(((((((.(((((((.....((((.....)))).....))).))))(((((((((....(((.((((((((..((((...(((.((((((((((((((.(((((..((..((.(((.....))).))..))..)))))))))))))).....((((...((((.....))))..))))(((((((....))))))).))))).)))...)))).((((..(((((((......)).)))))...))))......((((((..((...........))..))))))............))))))))))).))))))))).(((..(......)..)))..................................))))))).)))((((((((...))))))))))))).))((((((((((((((.........)).)))))))..))))).((((((((.....(((.......)))((((((..(....)..))))))......(((.(.(((((((((.(((.(((((...............))))).)))..((((...))))..((((((((((..((((.(((..........))).))))..))))))).)))....(((((.(((((((((..(((((...((....))....)))))))))))))))))))..(((((.............)))))...........(((...((((((((.(((....((((((((.(((....))))))).)).))...((((.(((..((((......))))..))).))))...))))))))))).)))..))))))).)).).)))...))))))))(((((..((((........))))..)))))...(((((((((((.((.........)).)))))...))))))...(((((((..(((.......)))...))))))).))))..)))))))))....))))))).))).)))))((((......))))(((((..((((((((....))))))))..))))).(((((((.(.....).))).)))).)))))).)))))))....))).)))))..))))).)))).)))))))))..((((((..((((...((..(((..(((((((...)))))))..)))..))..)))))))))).((((((..((((.....)))).))))))...))))).))))))))).((((((((...)))))))).(((((.(((((....).)))).)))))))))))))))).).)).)))).))))))))......)))))))))...........((..((((((...))))))..))........((((..(((((.(((.........................))))))).)..)))).))))).))))))))))).((((((((..(((((.((((.(((....))).))))..))))).))))))))..((((.(((...))).)))).............(((....)))......)))))...)))))))...))).))).)))........)).))))))........((((((.(((((..((((.....((((.(((.(((((...((((((((((...(((((((((.((((((((((.((((............(((...((((((..(((((...(((((((((...((((((((((.(((((((.((((((((((((.((((((.((((..........(((((((((...))))).)))).....(((((....((((.....(((.((((((.(((((.(((((..(((.(((((((.........(((((.....)))))..........))).)))).)))..))))))))))))))))...)))....))))....)))))...))))..(((.((((...(((.(((.....))).)))...)))).))))))))).))))))))))))..)))...)))).))))...)))))).............)))).)).......))).)))))........((((((((((.....)))))))))).)).))))...))))))).))).))).)))).)))))...........((((((......))))))))))))))))))))........((((((((((((((((((................(((.((((((.......)))))).))))))))).))))))...)))))).....))))))))..))))...))))..)))))....))))))............)))))))))))).(((...(((((((..(((........))).))))..)))...)))
Thermodynamic Ensemble Prediction
((((((..((((((...(({((((((({(((..(((((((((.((((((((..(((((((((((.(({..((..((((({{,..,{,....))).(((.((((((.({.........)))))))))))(((((((((.((((.(((((((((((((.{((((..{(((({,{({.((((((.,((,....,}}..)))))).|}},.,,.{.((((((({((((..((((((((..((.((((.(((((((.{{{((((.(((((((.......((((((((....)))).)))).{{(.(((.((......}).)))))}.))))))))))}}.........,,,..)).))))))).)))).)).((((....))))......((((,..........)))),,,,..))))}))))..))))})))))))..((((((..((.((((.....)))},.))..)))))).......|||||,.|},}||}}..,...},..)))))})))).,...))))))))....))))).))))....)))).)))))..,(((((.....,........}.....)))))).}))))..)).,(((((((((....(((((.{{,.....{{{{....(((((....)))))..}}},......{((.(((((.....))))).)).}((((((........))))}))})})))))..)))))))))))).)).)))).)))))))))))))....(((((.({...((((........)))))).))))).)))))))))......))))..)))))).(((((((......(((((({........)))))))....)))))))})))....((((((((((((((((((((((((((.((....(((((((,..{,....{{|,.{{{..(((..((((((..((((...((((...(((({.......),})))...........))))))))..))))))..)))..))).,,..(((((((,((((((((((...))))))))))..(((((......)))))(((.(((......))).)))(((((((((((((((((((((((((....))))).(((((.(((.((((.((({..(((((,..(((.((((.{(......(((({....}))))......)}.)))).)))..(((((...((......)).)))))((((((....))))))(((..(((((.......)))))..)))....|)))))}))).)))))))))))),((((((,(((((((((...(((((((({.{{{{{..,||||}.,,|||}}}......(((.(((....((((((((((((((((((.((.((((.(((((((.(((...,,..((((...))))...{{((...,,,{((((,{(((.((((...))))..))))))))}...,,..)).,...)))))))))).)))).)).))))..))))){{((((.(((..,....}..))))))}.}}......(((((((....))))))),.((((...(((((.((((.((....)).)))).)))))..))))}.......,.)))))))))...)))...))).((.((((((((((.((((((((..(((...)))..))))).,))),.((((((((.(((..((((((((.(((.,{({.,(({({{{,(((({|,{{{{{||{,,...{{{,|},,,})))}.{,,{.|}},...,,,)},,))}}..},}},...,},}}|||,(((((..((((....))))..)))))}},.))).))))))))..)))..)))).))))......)))).)))))))..|},,,.}},,,(((((((((...((((((((.((((.((.(.((((,...||||,((((.(((({.(((((..((({{((,(({{.(((((...({{......))})))))....))))))))))....)))))((((((........))))))...(((((.(((.((((((((..(((.{.(((((.(((((((.((((...((((..(((.(((({({{{{,||.,.{{{{{(|.,{({{,((((((((((({,((({{(,,.,{((({{,{......(((((,...(((((((..{(,.(((((((.{(({{{,..,{,,,((((((((.((((.(....(((..{{((((..((((..((...(((((((({,((((((((((((,(((.((,...,,,},.))),,,((((((((.(((((((((((.....(((((((((({{((.....}}))))|...{(((({{((({,...{((((.....))))|,{{|||,,|{||,,|{{(.((({{{{,.,...}},..,{(((((({|.((((......))))..,,.(((((....)))))...||.,,{((((((((((..((((......))))..)))))))),},...{((....}}|((((((({((...{(.....,....})}..)))))))}.|}}}}}}}..(.((((((((((...(((.(.(((((....(((.(((((((((((,,......,..)))))||{,.((((((.((((((((({..,{{{.,...{.((.(((((,{,,..{||..{(,(((((((((({{({(((((((((.,..{(({(((..,(({((.((((.(((.(,.{.,,.{||||,|||,||,|||||,((((........}}}}((({....}})}|||||}},}.|||..,}})}},,,)))}}}...........(({((.{{..{(({.,.,.}}||,}}.}}))),((((.((.(((((.....))))).)).}}})||((({{{{{{|,|.|{{((((((.(((((.(((({((((...(((...((((..{(((((.(.(((((..((((..{((,..{{,{{{{{....,,.....|.|{{.{(({{((.,,,((({{({{({,(,.,{{,,{{{{||,,,,,)})))})||,,,...}}})})).))),...}}}}}}.}}},)))|||||,,.,,.......(((((((..,.(((((.{{...)}.))))).}))))))}.........}))..)))).)))))).)))))}..))))....)))...)))).),....}))).))))).)))))||{{{.((((((((...(((....((((...........))))....))),..)))))))).}|||.....))})))}}...)}))},}.|.))}}}})})})))}))),))).))}}....,)}))))))},,{|||||...{{{|||,,.,|.|||..,,....))).}},))})),,})}}}},))))).)).}.,,)))))))))))).)))))),||},((((((...(({.....))}))))))...}}))))).)))..)))))).))).....)))))))).)).)))))))).}))})}))))))))}.})))))}))(((((....))))).}})).))).))))}}})).))).))))))))})))}}}....,.))))))))))))))))..)))).)))).)).))}).))))))))).))),{|,((((((.......)))))).)))))))))))))}},,))))))).}.}}))){{{((((((,{(({{{{{|..,,,|||{((((.....)))).}|||||}}}}}})))))}))))}))).)))..}})))))}.}})))))))))||||((({{((((.,((,((((.(((.(((.(((((..(((((.((((((((((((.((((.((((....({((((..(((({.......))))}.)))).)}...))))...(((((((...)))))))...(((.((((...((((..(((.(((...)))))))))).)))).))).{.(((..((.(((((.((((((((.((..((((..(((.....)))..)))).)).)))))))).))))).))..))).)))).))))))))))))|{{{({{{{{...{{(((,{{{{{,..,{{{{{|,,{{{(({{{,((..((((((.{((((........))))}.))))))..)}{|{,,,{{(((((((((.,,,,,|}}}}}}||,,({(((.......,,|||||,.......(((((((((.......)))))))))....{((({,,,|||,..{{,|{,{|{,,...,,,)),..,,))}}}..}}}}}})}}}|||.}}}}}...}},},,))))))...............,{{{{.{.,,......,,)))},,}})),...{{.{{{....})).}}.{((((....))))},,,{{{{(({.,,,,.{{,...{{|,{|,,{{{,||||{(({(.,{.{{((({{{.{((,(((({{{{{{|,||,....)).)))))..)),,))),)),.((({.((((((((((........)))))))))).}))).,,,(((..((((((((((....}})))}}..}),.)})))))}}.})))}},,.}},},,,))}.)}}|}.....))))...{(((...(((((((....)))))))..)))}....,}}},.}}},,))))}.,{{||{..,,,...,,,.........(((({{....................))))}}.}}}},,)))))..)))))))).))))))).))}})))))).)))|{}||||.|||||}|{.,.||{||}}}.,,,))))}))))))).))))..)))).)))))))))))),...)))..)))))},))..))).)))))....})))))))).{((((...,}}}}.{(((((({((......,)))..(((((((((.(((((,((((((((((((.(((.((......((((((((..(((((.((.((((((,{,..,,((.((((((.((((((((((.....((((....))))(((.((,...})).)))...{(((((.(((((.{..((((((.(((((.(((((((((((((....)))}},(,.,,,,..||,(((((..{(((((({.,,,........|||...{{{(({|||{,,..,..|}}),},....,})))).,,,})))))..))))))))))))).....))).)).,)))))),,).))))))))))}.(((((.......)))))....}))))))))).)))))).)).{,,.......,.{((((((((((((((..(((((((.((,,{((({((({((((....}))}.,,.....}}}}|||,.,(((({.{{...,|||}}}|}..|(({{(.({{{(({.....(((((((......))))))),{{{(,.{{{({.,....{{{,(((((((({(({{(({{{{{,,,,{{.(((((,,,..,,{.(({{(((,,,{((((,,,..{{||,,,..)))}.....|}}}|((((((((((((....(((,((((((({..{{{({..(((,(({{.(((((((((((((((..((..((.(((.....))).))..))..))))))))))))))....,((((...{{({,....)))}..)}))|((((((....))))))},})}}|,}}}...}}}|,{{{,..{({({|{,...,|)}.)})))...|||,..,,..{(((({..{{{,,........,,..})))}}......,,....}))))))))}).)))))))}},}}}..,..,,,.,,{|||...........,,,},},,....,,.........,},,,,,.}}}((((((((...))))))))|||}|((|.(((((((((((((.........)).)))))))..)))))}}}....}}}}})))}}}......,,,..,|})}}}}}}})..},)))))...)))),,{,,(((((((({(((.(((((...............))))).))).,((((...))))..(({(((((((..((((.(((..........))).))))..))))))).}}}....(((({.(((((((((..{((((.{.((....))..,.))))))))))))))}))))..((({{.............)))}}...........{{{,{{((((((((.(((....{{({((((.(((....))))))).)).||...((((.(((..((((......))))..))).)))).,,)))))))))))})})..)))))))}}}{(((({((({{..{{{{(((((..((((........))))..)))))}}}||||(((((((.{{...,,,,}})}.})))),,|}}}}},.....,}}}}.}}})}}}})}}))}}}))))).))}))}}..)))))))))....))))))).))).))))}.|{{|,,,,.||||(((((..((((((((....))))))))..))))),|{{{{{{.{.....}.})).))},.)))))).)))))))....))).))))),.))))).)))).)))))))),..((((({..((((...((..(((..(((((({...}))))))..)))..),..))))}))))).((((((..((((.....)))).))))))...))))).))))))))).((((((((...)))))))).(((((.(((((....).)))).)))))})))))))))),}.)).)))).))))))))......))))))))),}}}.)))...)))))))}..,.}}}}}}...,,..,}}}}}}}}}.,},}.,......},,})))))))},........((((((((((((((.......)))))......(((.(((((((({.(((((.((((.(((....))).))))..))))).))))))))...))).....)))))))))...............,)))))))).....)))))).,,,.....|||{..,...}}}},,{.||{...}}}|||{,,.,.,{{{{{{{.||(((,,{,.{..,{{...,..))}|}))}}...}}}}}}}))))}|{..((.(((((.,.....))))).)),.}}....,,...)))))))......))..)))))))))))).(((.((((.((({(({(((((.((((((.,..........,.))))))))}}},|.(((((((((...))))).))))..,,...)))}|}}))))))),,,.{((((((...,((({((((.....({{(((.((((((.....(((.(((((...,.{{(({.....,,.,......,,,.,|||||,,,}}}}}|},(((((..(((({(,....((((...))))...,,}}.)))).)))))....(((({{(((((..((((.(((..,,.(((((((((((((((.(((...))).)))},,..})))))}.,,}}}}}.}}....)))..))))..)))))))))).,,,.)))))....))))).)))...)))))).)))}}},||}}}}}}}...)}))))}{{(((((....}}}}}}},,||{{||||,,,|,.}}}}||||,,,.....|,||{........}}}.,..,,,{({((((,.....,,,,,..,..|||,|{||||.......)))))).,}}}}}}}}}.,,))))))))))))))........{,,....,||.,....{(((((.....)))))|............)))))))))))).(((...((({{{{,.(((........))).))))..)))...))}

Transcripts

ID Sequence Length GC content
GCUGCCUAGUCAGUUCUGCGUCCGCUGAGGCUCGGUCACCGCCUCGCUG… 7895 nt 0.5084
Summary

This gene encodes the transmembrane protein kinase inositol-requiring enzyme 1. The encoded protein contains two functional catalytic domains, a serine/threonine-protein kinase domain and an endoribonuclease domain. This protein functions as a sensor of unfolded proteins in the endoplasmic reticulum (ER) and triggers an intracellular signaling pathway termed the unfolded protein response (UPR). The UPR is an ER stress response that is conserved from yeast to mammals and activates genes involved in degrading misfolded proteins, regulating protein synthesis and activating molecular chaperones. This protein specifically mediates the splicing and activation of the stress response transcription factor X-box binding protein 1. [provided by RefSeq, Aug 2017]

Forensic Context

A study in rats demonstrated that inositol-requiring enzyme 1 (IRE1) and its phosphorylated form (p-IRE1) were negatively expressed in the cortex, hippocampi, and midbrain of both control animals and those subjected to fatal ligature strangulation, as assessed by immunohistochemical staining [Feng et al. DOI:10.1097/PAF.0000000000000298].