Basic Information

Symbol
ESR1
RNA class
mRNA
Alias
Estrogen Receptor 1 ER-Alpha NR3A1 ER Nuclear Receptor Subfamily 3 Group A Member 1 Estradiol Receptor Era ESR Oestrogen Receptor Alpha E2 Receptor Alpha Estrogen Receptor Estrogen Receptor Alpha E1-N2-E2-1-2 Estrogen Receptor Alpha E1-E2-1-2 Estrogen Nuclear Receptor Alpha Estrogen Receptor Alpha ESTRR ESRA
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Other applications

MANE select

Transcript ID
NM_000125.4
Sequence length
6327.0 nt
GC content
0.4693

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2050.90 kcal/mol
Thermodynamic ensemble
Free energy: -2166.29 kcal/mol
Frequency: 0.0000
Diversity: 1674.82
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((.(((((....)))))((((..((....))))))(.(((((((((..((..(((((...((((.((((((((((..(((((.(((((.(.((((.(((.(.(((((((....((((((((..(((((..((((.(((((((((((.....((.((((...)))))).....)))).....((...))(((((..(((((((.(((..(((.((((((.(((.(..(((.(.((...............(((...(((....)))...)))......((((.((((..(((((((.((.........)).).))))))....))))..))))((((((((((((..((.(((((.(((...((.....))...))).))))).))..))).)))).)))))...)).).)))..)))).))))))(((....)))..)))....))))))))))...))))).))))))).))))..)))))))))))))..((((.....))))(((((((...))))))).....(((((.((......)).))))).(((....)))))))))))))))))).).))))).(((((.(((....)))..))))).)))))....))))).....)))))..)))).....))))).))..)).))))))).)(((.........)))................))))))(((((((((.......((((((...((........))......)))))).....)))))).....((((((((((((((((..((......))..)))..((((((.(((...)))))))))((((((.(((((((....)))))))((((((((((........(((((((.........)))))))..((.((((..(((((((.....((((((((.(((((((((((((.((((..((..(((..((((.....))))..(((((((((......((((((...((.......))....((((((((..(((......))).((((..(.(((((((..((((((((((((((((.(((((((((((....((((((((.((((((((...)))))..)))...)))))).))......((((.((((...((((((((.....((((....((.((((....)))).))((((.((((((((.(((((((((.((((((......))))))....((.((((.....(((((((.((((.......))))))))))).....)))).))...)))....)))))))))..))))).))))....)))).))))))))..((((((((((.(......).))))))))))))))))))..(((((.(((..((((.((........))))))))).)))))((((.((((((....((((.((........))))))....))))))))))..((((((.((((....((((((..((((..(((..((...))..)))..))))..))))))..))))))))))(((.((....)))))...(((..((((((((((((((((.......................(((.((((..(((((((((((.((.((((....(((((((.((...((((((.........).)))))......(((((.((...)).)))))..((((.(((((((((((((......))))).((....))......((((((.((..(((((((......(((..(((.(((.(((((.((((..((......))..)).)))))...)).))).)))..)))(((.((((((((((((((....((((.(((.(.(((((...((.....))...)).))))))).))))))))))))))))))))))))))))..)).))..)))).))))))))...)))).......((((.(((.((((.(((.(((((((......((((((((.(((.((((((.(..((....))..).)))))).))).))))).).))((((((.....(((((((((..(((((((((((((((((.((((.(((...........(((((((((((((.((((...(.((((((....((((((((((.....))).))))))).........(..((((.((((.(((.((....((((((((((.((((......)))).((((.(((.(.(((........((((((((..............))..))))))..))).)..))).))))((((((........((.((((((.....)))))).))((.((((....)))).)).....))))))((((((((((((.(((((((...(((((...)))))((((...(((((((..(((((.((...........((((((...............)))))))))))))..)))).)))))))....)))))))..)))))).))))))...((((((((((((((((((.............(((((((((..((.....))..)))))))))((((..((.((((...)))).))...))))...........)))))))))))))))))).......))))))))))..........(((..(((((..((((((((.......((((((((((.....)))))...))))).....((((((((((((((((...((.........))...))))).))))...)))))))..))))))))...)))))..)))(((((.....)))))..((.((((((.....((((((..((((((...))))))))))))....(((..(((......)))..)))......)))))).)))).))).)))).))))..))))))))...)))).))))))).........))))))...........))).)))).)))))))))))))))))..))..........)))))))(((((((.((((....)))).)))))))......))))))))))))).))))))).))).)))))).))))))).....))))...)).))))))))).))..)))).))))))))))))..))))))).))).(((((((...(((...)))....)))))))((((....)))).))))))))))).))))))))..(((.(((((((((...))))))))).))).))))))))))))))))..))))(((((((((((((...((((((((...))))))))((.((((((...((((((((..((..(((.((.((...))))..)))..))..))))))))....))))))))..((((((((..(.(((((...((......))....))))).)..))))).)))....))))..)))))))))......(((((.((...)).))))))))))))))))))).))))))).)).)))..))..)))).))))))..)))))))..((((.((((.((....)).))))...)))).((((.((((((((.(.(((((((..((((((((.(.(((.....((((((((.....(((......)))..(((((.......)))))......(((.(((((((((....((((.....)))).....)))).....))))).)))...)))))))).))).).)))))).)))))))))))))((((((((((((..((((.(((((....((((...........))))....))))).))))..)).)))))......)))))..)))))))))...............))))))))))))))).....)))))).......(((((((((((((.((((.((((((....)))))).............(((((.((.((.((((......)))).)).)).)))))))))))))))....)))))))))))))))))......((((.((((..((((.(((((((((.(((..........))).)))))).))).))))...)))).)))).....((((((((((.....)))))))))).......(((((((....((((....))))....)))))))((((((((.((.....))...((((((.(((((....))))))))))).................(((((((((((((........(((((.....)).))))))))).)))))))))))))))....((((((........))))))...(((....))).........))))))(((.......)))....(((((((((........))).))))))))))))))....)))))..((((((((((((...(((((..((((((..((.((((.....................)))).))..))))))..)))))(((((((.(((..(((...................)))..))).)))))))..........((((((((.......((.(((((((.(((........)))((((...((((((((......)))..)))))))))((((((.(((((.....))))).))))))..))))))).))(((((((((((.((((((((((((((.....))).))))(((.((((((....(((((((.(((...............(((((..((((((((((((((.((((((.(...............(((((.....)))))....).))))))..))).)))))))))))..)))))..(((((.((((((...............((.((((((.(((..(((((.....(((((.....(((((.(...((((((..(((.((......)).)))))))))).))).))))))).....)))))..))).(((((((...)))))))...)))))).)).(((((((((..(((..((((..(((....((....))...)))..)))).))).))))))))))))))).))))).........))).))))))))))))).)))(((((((((((.(((((...((((.((......)).))))(((..((((.((((((((.............(((((((((((((........(((((.....(((((..(..(((.((.((((..........((((((...........))))))..........)))).)))))..)..)))))...)))))..((((((((....)))))))).................(((((.........))))).....(((.(..(((.(((((((.(((.((..(((.............(((..((((((.........))))))..)))(((((((((.((((.......((((......))))....)))).))))))))).))).)))))..)))))))..)))..).)))..((.((((((((.((((..((.(((.....))).))............((((((((((....(((......))).....)).)))))))).......(((((((..(((((((.............(((.((((.....)))).)))............)))))))..).)))))))))))))))))))).)))))))))))))................))))))))))))..)))..............)))))..))))))))))).))))))))))))))))))....((((......(((.(((.(((((((((.........))))))))).))))))..))))........(((((....(((((.(((((.(((....(((((((.((((((((((((((((.((((((.(((((..(((((((..((((.(((((..(((.(((((..(((.(((.((((((.(((((......))))).))))..))))).)))..)))))..)))....).)))).))))...)))))))..........(((((((((........))))).))))............))))).))))))........((.(((((((((((((((......))))))))...........).)))))).)))))))))))....)))))))))....)))))))).))))))))))....))))).))))))))..((((((.....)))))).....))))))))))))(((((.(((....))))))))..............)))(((((((...)))))))...............
Thermodynamic Ensemble Prediction
.((((((({,(((({{{{|||||((({..((,,,,|||}||{,,((({,,|({(({..,,||||.,((({.{{{{{{||||{,(((({.{((((.(.((((.(((.(.(((((((....((((((({..(((((..((((.((((((({,,,.....,,,((,({..,|||||...,{||}|,....(,,,{||((((,{,{((({{{.|||.||||}((((((.(((.,..(((,{.,{.....,,........{{{..,||{.,,,}}}...|}}..,.,.((((.((((.,((((((,.(,.........},},.))))))..,.))))..))))((((((((((((.{((.(((((.(((...((.....))...))).))))).)).}))).)))).)))))....,.}.))}..,))).)))))),{,....})))))).,...))))))))))}}.,))))}))))))).))))..)))))})))))))..((((.....))))(((((((...))))))).....(((((.((......)).))))).(((....)))))))))))))))))).).))))},|||||.|||,.,,))}.,))))),))}}}....))})),,,,,)}))),.}))),|,{.}||||,,||||}}}},|||||}|||,{{{{.,,(({|,,..,{.,{,,,{.,.,|||{{(,{((((((.....,,((((({.,,({..,.....|},.,,,,})))}},....}}})))},{,,({{{{{|{,|{{{||||,{|,|,.,|,},,}}}||{(((((.(({...}))))))))|,{{{,.(((((((....})))))).{{{{(((((((......(((((((.........))))))).,{{.,....{((((,..}}}}}....,,,..(((((((((((((.((((..((..(((..((((.....))))..{{(((((((..,...((((((...{{.......}}....((((((((..,{{....,,,},.((((..(.(((((((..((((((((((((((((.(((((((((((.,{,({((((((.((((((({...}))))..)))...)))))).))......(((,{((((...((((((((,,.{{(,{,,}}{((,((((....)))).},|||{.((((({{(,{{{{{{{||,|{((((......))))}|,,,,{{,((((.....(((((({{((({,......))))))))))).....}))).}}..,)))..,,)))}}}}}},,))))),}))},..,)))).))))))))..((((((((((.{......).))))))))))))))))))..(((((.(((..((((.((........))))))))).)))))((((.((((((....(((,{((........))))))....))))))))))..((((((.((((..,{((((((..(((({{,(({,,...,))..)))}}),))..))))))..))))))))))(((.({....}))))...{{(,,((((((((((((((((.....,.,{.......,}},...(((.((((..(((((((((((.((.((((...,(((((((.((.,.{((({,....,....|,|}||}{,,,,,({(({.{{...}),))})),.((((.(((((((((((((......))))).,,.,..||....}}((((((.((..(((((((,{,,{{({{..{((.(((.{,,,,}||||..,,.,,}.,)),.}}.|||||,,.,}.,,,.)))}.}))(((.((((((((((((((....((((.(((.(.(({{(,.,({....,)),..)).))}}))).))))))))))))))))))))))))))))..)).)),.,))).))))))))...))))}}},...{(((.(((.(((,{(((.(((((({......({((((((.(((.((({({|||,{|....)|..|.}}}}}).))).))))).}.))((((((.....(((((((((..(((((((((((((((((.((((.{{{......,{,,,{{{{{((((((((.((((...(.((((((....,{((((((((,....|||.}}}}|}|,.,,{{{{.({{,,(({(((({,(({{(({..,(((,,(((,{(((,{{{.{{|,,..((((.(((.(.(((........((((((((..............)),.})))))..))).)..))).)))),,,|||.}}}.}}}|,}||{{||,....}||}||{||((,({((....}}}}.|}.....,}}}}},|||{|||{|||,|{||{((((.(((({...}))))}))}...,{{{,,{..{{{,|,||},}}}}}}},.|||{{{,,,}},,....,..,|}}}}}}})))}}..)))||}))}|}},..,)))))))..||||||.,},}}},.{(({(((((((((((((((.,{((.,......(((((((((..{{.....}}..))))))))){(((.,{{.((((...)))).}||..)))}...))}}....)}))))))))))))))))....,{{|||}|||}}|{{{{.{{..{((,.{((((,..{((((({(,,..,,,((((({{(((,....))}}}...)))))..||}((((((((((((((((...((,........))...)))))}})))...))))))),,)})))}}),,.,)))},})))|,,||}..,},))))}..|||||||,..,.,{{,,,,..,,,{||,..))))))}}})))},,.|,|.{((({{{{,{|,,..}})}}}).}}))))},}}|},}}},}))),))))...)))))))...)))).)))))))},,.....,))))}|,||,...,},,))).)))).)))))))))))))))))..)),.........)))))))(((((((.((({....}))),)})))))......))))))})))))).))))))).))).)))}}}.))))))).,...))))...)).))))))))).))..)))).))))))))))))..))))))).))).(((((((...(((...)))....))))))){{{{....)))}.))))))))))).)))))))}..(((.(((((((((...))))))))).))).)))))))))))))))}..)))){((((((((((((...((((((((...)))))))){{.((((((,{.((((((((..((,.(((,({.{{,,,))})..}}}..})..)))))))),,..)))))),}.,{(((((((..{.{{|||}|||{.,,,,,||..,.}}}}}.}}}))))).}}}....))))..})))))))}......(((((.({...}).))))))))))))))))))).))))))).}}.)))..))..)))).))))))..)))))))..,{{{.{{({.((....)),||,,...}},,{(((,...,,||||.{.(((((({.{{|((((((,{.{{(,....{{((((({.....{((.....,))}..{({{{.......}})}}.....,{{,.(((((((((..,.,{{{.,,,.)})}..,..)))).....))))).,},}}})))))))).))}.}.)))))).)})))))))||))||||||||{{{,.,(({{.(((((.{{{((((,...,,}}},,)}}|,||.|}}}|,|}}},,,,.}}))}.})}||}},,,,}}|}}|||||{{(((((((((((({|,,,,,,,{({{,{{{{{{,,|||,|{||{..,|{{{{{{(({{{,,{{{{|{{{{{{..,,}))))},,,,,,,,}}},||{,{,,||,||},{||},.,,,|}}}.}}|}},}}))},}}||||||,.....}}}|||{{{{{{{,........((((.((((..((((.(((((((((.(((.{,,...,},))).))))))})}).))))...)))).)))).,...,|}}}}}|}}},..,.,))))))))))))))}|||{{{|,},,||{{....)))),,},)))))))|{|,{{{,,||}...,})}}}((((({.(((((....}))))})))))...,,,...........(((((((((((((........(((((.....)).)))))))))}}))))))}))))))}..{{{......,}}((((((({{{{((((((((.{,.....}}.)))))))))..}}})))))))....(((((((((........)))))))))),}})))))}..}))))),.((((((((((((...(((((..((((((,,((.((((,......,,,,,...,,....,},,.}}..))))))..)))))(((({((,({{..{((.,{,,..............))}..))),))))}})..,,,,,...((((((((..,{{{.((.,(({{{{.,||.,,...},},|((((...((((((((,.....))}..))))))))){(((((.(((((.....))))).))))))..|||,,,,,)){((((((((((.((((((((((((((.....)))}})))(((.(((((({...,((((((.(((...............(((((..((((((((((((((.((((((.(...............(((((.....)))))....).))))))..))).)))))))))))..)))))..(((((.((((((.............,,{|.{{{{{{.(((..(((((.....(((((.,{,.(((((.{...(((((({.,((.{(......)).)})))))))}.))).)})))})}}},.)))))..))).(((((({...}))))))...}}}}}},}}.(((((((((.,{({..(({(,,{{{....{{....}}...))).,)))).))).))))))))))))))).))))).,,...,..))).))))))))))))).)))(((((((((((.((((({,,((((.((......)).)))){((..((((.((((((((.,.{,,,......(((((((((((((....,,,.{({{{.,,,,((({,,,,,{(((.{,.({{{....,{{{{,{(((((.,........,)))))|........,,|||}.|,}||.,,,.,,,}}.,,}}))}..((((((((....)))))))).............,,..{((((.........))))}.}}}}}},|{,|{,,.{{,,,{|||||.{,..,{{.............{{(..{(((((.........)))))},,))},{|||||||.{|||||||,},{{{{......))))..,,|},..,,,,..||||}}|{|,}||{{|||||||,,|||,,||||,..|{|,,,,,{{{||||,..||.|||,....})).,||,.......,,.|(((((((({{{{,(((......})},},..,,.)))))))},}))))))}..}}}.}|||,,,,..,..,,,.....(((.((({.....)))).))).......,.,..}}}}|||.{{{{{.....)))))))),,,,,.))))))))))))).......},.......))))))))))))..}}}............},}})))..))))))))))).)))))))))))))))))).,..((((......(((.(((.(((((((((.........))))))))).))))))..))))..,,....,{{((,,{.(((((.(((((.{{{....{((((((.(((((((({(((((({,((((((.(({{{..{((((((..((((.(((({,,(({.(((((..(((.(((.{,((((.(((((......))))).))))..||})).}))..)))))..,,..,..).)))).))))...))))))),.....,,,,|||{,,,,{{{,......}})}|}}||,,,.........))))),)))})).,.....,((.(((((((((((((((......)))))))).,.........),}})))).))}},))))))...,)))))))))....)))}},),.))))))))))..,,)))},.))))))))..((((((.....)))))).....))))))))))))|||||.{{|,,,.)))))))).........,,,.....(((((((...))))))).,}},,.........

Transcripts

ID Sequence Length GC content
AUGCAACCGCACACCCCAUUCUAUCUGCCCUAUCUCGGUUACAGUGUAG… 6291 nt 0.4635
AGCUGGCGGAGGGCGUUCGUCCUGGGACUGCACUUGCUCCCGUCGGGUC… 6143 nt 0.4662
Showing 11 to 12 of 12 entries
Summary

This gene encodes an estrogen receptor and ligand-activated transcription factor. The canonical protein contains an N-terminal ligand-independent transactivation domain, a central DNA binding domain, a hinge domain, and a C-terminal ligand-dependent transactivation domain. The protein localizes to the nucleus where it may form either a homodimer or a heterodimer with estrogen receptor 2. The protein encoded by this gene regulates the transcription of many estrogen-inducible genes that play a role in growth, metabolism, sexual development, gestation, and other reproductive functions and is expressed in many non-reproductive tissues. The receptor encoded by this gene plays a key role in breast cancer, endometrial cancer, and osteoporosis. This gene is reported to have dozens of transcript variants due to the use of alternate promoters and alternative splicing, however, the full-length nature of many of these variants remain uncertain. [provided by RefSeq, Jul 2020] CIViC Summary for ESR1 Gene ESR1 has been a focus in breast cancer for quite some time, but is also clinically relevant in endometrial, ovarian and other cancer types. The identification of ER-positive breast cancers that are resistant to hormone therapy have inspired clinical sequencing efforts to shed light on the mechanisms of this resistance. A number of mutations in the ligand binding domain of ESR1 have been implicated in hormone resistance and anti-estrogen therapies. These observations have spurred efforts to develop therapeutics that stimulate ESR1 protein degradation (e.g. Fulvestrant), rather than acting as a small molecule antagonist. These agents are currently in clinical trials and have seen some success.

Forensic Context

A study in humans developed a multiplex RT-PCR assay for vaginal fluid identification, where the ESR1 was evaluated as an mRNA marker [Akutsu et al. DOI:10.1016/j.legalmed.2020.101715]. A study in human menstrual blood-derived mesenchymal stem cells demonstrated that the ESR1 mRNA expression was remarkably increased in cells from endometriosis patients compared to those from healthy women [Sahraei et al. DOI:10.1155/2022/7053521].