Basic Information

Symbol
EXOC2
RNA class
mRNA
Alias
Exocyst Complex Component 2 SEC5L1 Sec5 Exocyst Complex Component Sec5 FLJ11026 SEC5-Like 1 (S. Cerevisiae) SEC5-Like 1 NEDFACH Sec5p SEC5
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_018303.6
Sequence length
4456.0 nt
GC content
0.4468

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1310.60 kcal/mol
Thermodynamic ensemble
Free energy: -1396.43 kcal/mol
Frequency: 0.0000
Diversity: 1031.63
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........((((((((((((.((((..((..(((.(((.((((((...))))))((.(((((....)))))...)).))))))..)).)))).))))))))).((((((((((((((((.((((.((........)))))).))))).((((......))))...((((........))))....((((((((((((((.((((((........)))))).)).........)))))))...)))))(((...)))((((((((..(((((((((.......(((.....((((((((((((..(((((.......))))).....)))))))))))).....)))..)))).)))))....((((....((((...((.((((....)))).)).....))))..)))).(((....)))..))))))))((((((((.((((....))))......)))...)))))(((((..((.(((((...((((((......))))))...)))))))))))).((((.(((.((........)))))))))..)))))))).....)))((((((((((((((...((((((((....(((.((((((((((.(((((.((((((....))))((..((((((..((((((.(((((((((((...((((((...((((...(((.....))).....(((.(((((((...))))))))))..............))))..)))))).((((((((((((((....((.((((((.((((((((((((((.((((...((((((((((((((((......((((.(((.((((((..............))))))............(((((((...((((((......(((((..((((((....))))))..(((((((..(((((...))))).....))))))).(((.....))).((((((.(((((...((((((..(((((.(((.(((.(((((..((..((((((((((..((......))..))))))))))..))...(((((((((...((((((((.((((..((((((.(((((((.........((((..((((((..........))))))..))))......((((.........((((..(((((((((((.(.((..(((((((((((((.((((((((.......)))((((((..((((.......))))..))))))..(((((((((.(((((((((.((.(((......))).))))))).))))(((((((((.(((.((....)).)))..((((....))))..(((((..(((((...((.(((..((((.......))))...)))))(((...)))(((........))).)))))))))).))))))))).......))))))))).((((((....)))))))))))....(((.(((((((((((((...((((.((........)).))))(((....)))(((((((....)))))))...))))))))).))))))).........(((((((.((((.((((((..((...(((((.((((((((((..((((((.(((((..((.(...((((....))))...((((.(((((...................((..(((((((((.((.((((..(.(((((.(((((...))))).).))))....((((((((((.........)).)))))))).......(((((...(((((.((((....(((((((((......)).)))))))...)))).))))).))))).)..)))))).)))))))))..))..)))))..))))...(((..(((((.(((((((((((((((...))))))))).((((....((((((((((((....)))))).))).))).))))........(((((((((((.........(((......))).........)).))))..)))))........)))))))))))..)))).))..))))).)))))))))))))))).)))))....)).....))))))..)))).)).))))).............((((.(((((..........((((((((........(((((((...(..(((((.....)))))..).....)))))))..(((((...((((.......)))).))))))))))))))))))))))..)))))))))))))))).))))).)))))))))).........))))))))))).)))))).....)))).))))).)))......))))).)))).......))))).)))))).))))...(((.((.(((((((...(((.............(((((((((((..((..((....((((.((((((((...))))))........)).)))).....))))..)))).)))))))..)))...))))))).)).))).)..))))))...)))))...))))))..)))))....))))))..............(((((((((((((((((...(((.......)))...))))))))))..((...(((((((((((((.((((...)))).))).))).....))).))))...))((((((....)))).))...))))))))))))))(((.........))).....))))))).......)))))))))))))))).)))).)))))).............((.(((((((.(((((....(((((((((((..((((((((((((((((((((((..(((((((...........((((((((.(((((((.((....((((.(((......))).)))))).)))))...)).))).))))).......(((....)))...)))))))..)))....((((((.(((((...((((.((......))))))......(((((((((.....)))))))))(((.....))).(((.....)))...............)))))..)))))).......(((((........)))))..(((((....)))))(((((((......(((((.((((.(((((((((....(((.....(((((((.((.(((((((....))))))).........(((.((((((.....))))))))).((((......)))).))))))))).....)))))))))))).)))).)))))...)))))))(((((.((((((((..((.(((.......))).))..))...)))).)).)))))((......))...))))))))((((((........(((((......((((.(......).))))................(((((.....)))))(((.((((((((((((.............)))).)))))))).))))))))......)))))).......)))))))).........)))))))).)))))).....))))).))...))))).))..........)))))))))))))).)).((((........)))))))))))))..)))))(((((((........)))))))....((((..((...))..))))(((.....(((((.((((((((((((((....(((((..((((.(((((....))))).(((((((.(((((..((((....)))).((....)).....(((.((...)).))).)))))....)))))))...(((((((((((((((..((.......))...)))))))))))))))(((.(((....))).)))...((((.(((((((((........((.((((....)))))).((((((..(((....)))...))))))))).)).)))).)))))))).)))))))))))))).((((.((((((...(((((..((((((.((...)).)))))).)).))))))))))))).......))))).)))))....))).((((((....)))))))))))))))))))))))))))))...)))).))))).)))))))))).))))))))))).))))))........)))))))).(((((((....)))))))(((..(((.(((((..((((((((.((((((....((((((.((((.....(((..((((((........)))))).)))))))))))))..)))))).))......((((((......))))))..((((((((((((((..((....))..)))))......)))))))))....((((....))))...))))))..))))).))).....))).....(((((((((((((((((...))))))....)))).))))))))))..(((((.......))))).
Thermodynamic Ensemble Prediction
........((((((((((((.((((..{(..(((.(((.((((((...}))))}((,(((({....})))),,.}),))))))..)).)))).))))))))).{{((((((((((((((,(({,.,,,,,,,...}}}}}}.))})}.((((......}))}...((((........)))}..,((((,((((((((((.((((((.,....}.)))))).)).........)))))))}...)))),{,....,|(((({{{(.,(((((((((.,.,..,(((,....((((((((((((..(((((.......))))).....)))))))))))).....}}}.,)))).)))))....{(((....(({{..{((,((({....||||,||.....}}}},,)))),(((....)))..}}))))))}},,,,||.((((....))))....,,}}},,}}}}}.{{{({,{((.(((({.,,((((((......))))))..,}))}))}))})},((({,({({((........)))))))))..)))))))}....,)))((((((((((((((...((((((((....(((.((((((((((.(((((.(({(((....}}}}|{..((((((..((((((.(((((((((((...((((((...((((.,,(((.....})}.....{(,,(((((((...))))))))))...........,,,))))..)))))).(((({(((((((((....((.((((((.((((((((((((((.((((...((((((((((((((((.{....((((.(((.((((((..............)))))).,.......||.(((((((.,.((((((......(((((..((((((....))))))..(((((((..(((((...})))},....))))))).(((.....))).((((((.(((((...((((((,.(((((.(((.(((.(((((.,,{..((((((((((..{,......,}..))))))))))..},...(((((((((,..((((((((.((({..((((((.(((((((,,,{.....,||||,{{,,,{.{{{{{.,..||||||,{|,||,.,,,{{({({{{{{{...,{((,.,{{{{{{{|{{.{.{,.,||||||{|{||||,},,}|||||,.....,,.((((((..((((.......))))..))))))..(((((((((.{{((((((({,({({,....}}}.)}),,,)))},))}(((((((((.(((.((....)).)))..((((....))))..(((((..(((((...((.(((..((((.......))))...)))}}({,...})){{{........)}}.)))))))))).))))))))).......))))))))).((((((....)))))).|||{,...,{{.{((((((((((((...({((,({.......,)),}}}},{{,,,.}}|(((((((....))))))),..))))))))).)))))))}....,|{|(((({((.((((.((((({..,{...{((((.(((((((((({.,{((((.(((((..((.({..((((....})))...((((.((((((,..,,,.....,.||||.,{..(((((((((.(,{((({.,,.(((((.(((((...})))).).))))....(((((((({{..,....,.}}.))))))))...|,..({(((...(((((.((((..,.(((((((({......,).))))))).,.)))).))))).))))).,.,)))))).)))))))))..,)),}))))..))))...(((.,(((((.(((((({((((((((...))))))))|{((((....{(((((((((((....)))))).))).))}.)))}.},.....{{{{{{(((((........,|{|}},.,,}}},,|,.,{..||.,,,,..))))}..,,,}}}))))))))))).,))),,),,,))))).)))))))))))))))).))))},.,,,,..,}.))))))..)))).)),))))}.............((((.(((((..........((((((((,,......(((((((...{..(((((.....)))))..,.....)))))))..{{(((...((({.......)))).)}))))))))))))))))))))..})))))}}}}}},))).}))}}.)))))))))),,,}}....}})}))))))).))))))....,)))).))))).)))......))))).)))).......))))).)))))).)))}...(((.((.(((((((...,{{......{{,...{(((((,,,|||}}|,..||,...{,{{.({(({{{(,,,|}}||}......,,,},)))).....,.}},.|||}.}}))))}..,,,...))))))).)}.))).}..))))))...)))))...))))))..)))))....)))))}|,............(((((((((((((((((..,(((.......))),..)))))))))).,{{...,{{{(({((((((.((((...)))).))).))).....})))))})}|.,.{{{{{{....)))).))..,)))))))))))))){|{......,..})}.....)))))))...,...)))))))))))))))).)))).))))))},.........,.((.(((((({.(((((....((((((((((({.{({((((((((({(((((((((..(({{{{,....|||}||||||{,((((.((({....}))}.||||,(({,,,...}))|||||.,{{{||,,,,|||||||{{{((,....,}|,|,.........}}}}|||{{||,....((((((.(((((...,{,,.{{......}}||||....,.(((((((((.....))))))))).}.....,}}}.(((.....)))...............)))))..))))))......}||{||},..,,,,|||},..{((((....)))))||||||{..,...{((((.((((.((((((({,...,{({..,..{((((((.{,.{((((({....})))))).......,,(((.((((((.....))))))))).{{{{,,.,..)))),),})))))),,}..}}}))))))))}.}))).})))},..}}}}))){((((.(((((({{..((,(((.....,.)))|)|..}}...)))).)).))))}{{,.....||..,}}}}}}}}{{{({(,.......{|||{|,|...{{{{.|......),)))).,}}))},........,,,,,.....,}}}|(((.(((((((((((({{{....}}),..})))))))))))).)))}.}}}......,,,,,,......})))))))).........)})))))).)))))).....))))).)}..,))))).)).,........,})))))))))))).)).((({........))),)))))))))..}))))(((((((........)))))))....{(((..({...))..))))(((.....(((((.((((((((((((((....(((((..((((.,{((({{{{|||}|.{(((({{.{{|||,.,|||,,}|})}|.{{....}}...||{{,.|||||}},|}}.|||}}....,})))})}},(((((((((((((((..{,.......},...))))))))))))))){{{.(({....})).})}...((((.((((((,,{{{{.,,,.,,,((({....))))}|.(({{{{,{({{..,}))}...))))))))).)),}))).)))))))).)))))))))))))).((((.((((((...((((,..((((((.((...)).)))))).},,))))))))))))).......))))).)))))....))),((((((....)))))))))))))))))))))))))))))...}})).))))).)))))))))).))))))))))).))))))........)))))))}.(((((((....)))))))(({.,(((.(((((..(((((({{,({{(((.,{{((({{({{{(({{,..,{{..((((((........)))))).,,}}}||||||||,.}}}}}}.}}......((((((......))))))..,,,{,(((({{{{||||,}}},},..,})))})}}}}))))))),,}}}}}},|,..,,,,}...))))))..))))).))}...,,))).....(((((((((((((((({...})))))....)))).))))))))))..{{{{{.......))}},.

Transcripts

ID Sequence Length GC content
ACACGCUCGGCGCUCGCGGCGGGCGGAAGUGAGGUGCCGGCGGCUGGCG… 4456 nt 0.4468
Summary

The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Forensic Context

No relevant information is available at the moment.