Basic Information

Symbol
F12
RNA class
mRNA
Alias
Coagulation Factor XII Plasma Coagulation Factor XIIa Hageman Factor EC 3.4.21.38 HAF Coagulation Factor XII (Hageman Factor) Coagulation Factor XIIa Heavy Chain Coagulation Factor XIIa Light Chain Beta-Factor XIIa Part 1 Beta-Factor XIIa Part 2 EC 3.4.21 HAE3 HAEX
Location (GRCh38)
5:177402133-177416583
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Postmortem interval inference Drug abuse diagnoses
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000505.4
Sequence length
2036.0 nt
GC content
0.6498

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-890.60 kcal/mol
Thermodynamic ensemble
Free energy: -923.20 kcal/mol
Frequency: 0.0000
Diversity: 636.87
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((...((.((((((.((...(((((((.((..((.(((((.((((((..((.(((((((((((((((....(((((((.........)))))))(((((((.....)))))))(((...........)))..(((((........))))).((((.....((((((........))))))....))))..))))))))((((...................((((((.....))))))))))..(((((...))))).(((((.(.(((........))).).))))).........))))))).))..((((......)))))))))).((((((.((((.((.....))))))..))))))......((...))))))).))..)).)))))))....(((((((((((((((((......((((((..(((.((((((((.((((((((((.((((((.(((.............)))...))))))))).))))(((((.(((.(((.(((.((((((((((...((.((.(((.(((((((.(((((..(((((((..((.(((((..((((((....))))))))).)).)).....(((((....)))))))))).))....((((((((.....)))))).)).(((((.(.((.(((.....((((..((((((.....((((((((.........))))))))((((((((.(((((((..((((.....))))..)).))))).)))....)))))....((((..((((..(((((.((..((((((..((((((((.(((((....)))))...(((((....((((...((....((((((((((((((((..(((.(.(((....))).).)))..)))))))))))..((((((...))))))...........)))))))..))))...))))))))))).))....((((.......)))).)))))).)))))))..((.((....)).)).))))..))))..(((((.((..((((.......))))(((.....))))).))))))))))).))))))).)).))))))(((((.(((..(((((.((...(((((........((((((((..(((((.....)))))..)))))))).(((((.(((((((.((((...........)))).))).))...)).))))).(((((((.(((((((.(.((.(((...(((..(((((((....(((((.((.(((....))))).))))).))))))))))...))).)).).))).))))))))))))))))..)).)))))))).)))))))))).))))))).))).))))..))).)))))))..)))..))).)))...)))))....(((((.((.((((..((.((((.((((((.(((.(.((((((.(.((((((.(((((((.............((((((((..((....))..)))))).))...((((((...((.(.(((.((..(((((((......))))))).))..))).)))))))))................))))))))))))).).)))))))))).)))))))))).))..))))..)).)))))..((((((.......((((((((..(((((((((..(((.((((....(((.(((((..(((.(((.(((....)))...))).))))))))))))))))))..)).)))))))(((.((.......))..))).......))))))))...((((((((...))))....))))..(((((......)))))((((........)))).))))))((((((.....)))))))))..)))))))))))..))))))......))))..))))..))))))...)))(((((((.((((.(.(((....))).).))))..)))))))..))))))))))...)))))).(((((..............))))).............
Thermodynamic Ensemble Prediction
..((((((...((.((((((.((...(((((((.((..((.(((({.((((((,.((.((((((({(((((((,{,,(((((((.........)))))))(((((((.....))))))),{{....,......|||,.,{|||...,,,,.}}}}}}||||},,,,((((((........}}))))}...,|||{,||||||},((((,,,.......||,,.....((((((.....))))))}))).}}|||}}}}}.,,..(((((.(.(((........))).).))))).........))))))).})..((((......)))))))))}.((((((.((((.((.....))))))..))))))......||...)}))))).))..)).)))))))....({(((((((((((((((..,...((((((..(((.((((((((.(({(((((({{((((((.(({.............)))...))))))))).))))((((({(((,{{{.{((,((((({((((,,,(,.((.{{{.((({((({(,((((.....|||}.|}}|},,,..((((((....))))))|||.||{||{{.,.(((((....}}}))||||(((((((.{({((({(,,,..}}}})),)),,.,,},,..)))).))),.}))),.}},})}.,,.,((((((((,{,,,{,,,|}|||}||{||||||,|||{{,,{{,,(((((((((((((,(((,((((((({((((((,..}}}.}|||...,,,..,((((.(({{(({(((..(((((((((((((((....,,,...{(((((...)))).)}..,...{(((..(((((.(((.,{.(((...,,(((.({(((((,({.(((|||..|{.{,,((((({...}))))).......{(.(((.((((((.........)))))).))).))...,,,|}}.},..}}},))))),))))))),..))).}.)))}..})))))))...)))}..})))).))))))),}.,,}})|}.|{|}}|||||}(({((((......)))},}||({{....})),..)))))}).(((((((.....))))))){{{...((((((((..(((((.....)))))..)))))))).||}}|}}}..})|}||}}}})))......,|||||||,}}|}||}}}}},)))}|||||}||||||||{,{{,{{||..{{{..||||||{,,..(((((.((.(((....))))).))))),))))))))))....},,}))))),)},)))))))..}|||}}..,,.{|||||||||||}||}}||.}||}|||,|}|,||||..}}}.|}||}}|..||}..})).)}}|,,|}}}}....(((((.((.((((..((.((({{((((((.(((.(.((((((.(.((((((.(((((((,({,....,,,,,(({(((({{{(({,,.,},}))}}|}.|},||({{({(.,.{{.{.|||.|,..|||{|||,,,...))))))).)}..))),)))))}|||.........,.,,,},))))))))))))).).)))))))))).)))))))))).))..))))..)).))))).,(({{((,,,..,.{(((((((,,(((((((((..((,,({{{..,.||,|{{{{|,.|||,|||.|||.,,.,}},,,))},))))))))})))))))))..)).)))))))|||}||,.,,.,})),.))).}},.,}))))))},.,,|||{((((,..))))}.,..|||,|({(((,,,,..}})))||{{.....}}})))}.)||||}((((((.....))))))}))..)))))))))))..))))))......))))..))))..))))))...)))(((((((.((((.(.(((....})).).))))..)))))))..))))))))))...)))))).{{{(({,....{,,,....}},},}}},...,,},..

Transcripts

ID Sequence Length GC content
NM_000505.4 NCBI
ACUCCUGGAUAGGCAGCUGGACCAACGGACGGAUGCCAUGAGGGCUCUG… 2036 nt 0.6498
Summary

This gene encodes coagulation factor XII which circulates in blood as a zymogen. This single chain zymogen is converted to a two-chain serine protease with an heavy chain (alpha-factor XIIa) and a light chain. The heavy chain contains two fibronectin-type domains, two epidermal growth factor (EGF)-like domains, a kringle domain and a proline-rich domain, whereas the light chain contains only a catalytic domain. On activation, further cleavages takes place in the heavy chain, resulting in the production of beta-factor XIIa light chain and the alpha-factor XIIa light chain becomes beta-factor XIIa heavy chain. Prekallikrein is cleaved by factor XII to form kallikrein, which then cleaves factor XII first to alpha-factor XIIa and then to beta-factor XIIa. The active factor XIIa participates in the initiation of blood coagulation, fibrinolysis, and the generation of bradykinin and angiotensin. It activates coagulation factors VII and XI. Defects in this gene do not cause any clinical symptoms and the sole effect is that whole-blood clotting time is prolonged. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that short-term alcohol administration induced liver injury, with single-cell RNA sequencing revealing that the F12 was upregulated in hepatocytes of alcohol-fed mice, implicating it in the complement and coagulation pathways associated with the pathogenesis of alcoholic liver injury [Cao et al. DOI:10.3390/Ijms24054344]. A study in mice demonstrated that the F12 mRNA quantity in brain tissue increased after death and was significantly correlated with the post-mortem interval (PMI) over 0-48 hours, with a stronger correlation observed during the initial 0.5-4 hour period [Scrivano et al. DOI:10.1007/s00414-019-02125-x]. Further research in a mouse model confirmed that the F12 expression in brain tissue increased post-mortem and showed a significant correlation with PMI up to 48 hours, while no significant correlation was found in heart tissue [Peng et al. DOI:10.1007/S00414-019-02199-7].