Basic Information

Symbol
F13A1
RNA class
mRNA
Alias
Coagulation Factor XIII A Chain F13A Protein-Glutamine Gamma-Glutamyltransferase A Chain Coagulation Factor XIII, A1 Polypeptide Coagulation Factor XIIIa Transglutaminase A Chain EC 2.3.2.13 BA525O21.1 (Coagulation Factor XIII, A1 Polypeptide) Coagulation Factor XIII, A Polypeptide Fibrin Stabilizing Factor, A Subunit Transglutaminase. Plasma FSF, A Subunit Fibrinoligase Factor XIIIa TGase
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_000129.4
Sequence length
3828.0 nt
GC content
0.4616

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1168.60 kcal/mol
Thermodynamic ensemble
Free energy: -1239.57 kcal/mol
Frequency: 0.0000
Diversity: 1003.43
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((.(((((..((.....))..))))).)).((((..((((......))))..((((((((((((.((((((((.....((((((.............((((((((.((((..((((((.((.((((...........((((((.....(((((.((..((((........))))...)).)))))......)).))))))))))))))))....))))...)))))))).........(((((......)))))...((((((((((.(((((((.((((((....)))).))....(((.((.......)).)))((((((((.....))))))))((((((..(((((((((....)))))(((.....)))((((((((((.((((((..((((((....((....))....))))))..))))))..((((((..((((((....((((...((((((.........((((.(...((((((((((.(((.((((..((((.((((.(((((.((.(((((((......)))))(((((((((.....))).))))))..(((((((((((((..((((((((((.((....)).))..(((((.....)))))..)))))..)))..))))))))............(((..((((((((((((((((...(((.(((.((((((........(((((((.((((((((......))))))))))))))).((((((((((...))).....(((((..(((....))).)))))...((((((((.((.((((........(((((...((..((((.((((((...((((...(((((.....)))))...))))...........(((((((((((.(..((((....))))...(((.((((.((.((((..(((((((((((((((((((((((...((((.((((((.(((..((((((((((((((((.(((..(((((...)))))..))).))).......)))))))))....)))).......(((((((((((((((.(((((..((((.....))))..))))))))))))))))))))(((((.(((((((((((...((((.(((.((((((((....(((((.((.((((....((((((.((((.((..((((..(((((((.(((.((.(((.((((.((.......(((.((((.......)))))))........))))))...))))).))).)))))))((((.....(((.((........)).))).....))))((((((.((.(((((.(((....))).))))).)).))))))...)))).))..)))).))))))....))))..)).))))).......((((((......)))))).......................))))).)))))).))))..(((((((.......))))))))))))).)))))))))).........))).)).)))).)))))))))))))....................(((((((......(..(((((((.(((.............(((.(((..((.(((....))).))...))))))..(((((.(((...((((((((((.........)))))))))).((((....((.(((.((((((........................)))))).))).)).))))...))).)))))......))).)))))))..).......)))))))........)))))..)))....))))))..)))).)).)))).))).((.(((((((((((...........(((((((...(((((((((.((......))...))))))))).(((((((....((((.((((((......(((.((((((((......((((((((((.....(((((...((.....(((((.((((((.....((.(((........))).))....))))))((((((.((((((...(((.((((((...)))))).))).))))))............((((.((.....))..))))..)))))).(((((.((......)).)))))(((..(.((.((..(((.(....))))..)).)).)..)))...))))).....))..))))))))).))))))..((((((((...))))).)))..((((.(((.((.(((...))).))))).))))))))))))))))))))).......))))...))))).))((((((.((((...(......)...)))))))))).)))))))(((((((((.((..((...(((..((........(((....))).........))..)))...)))).))))))))).))))))))))).))).)))))))))))............)))))))))).)).))))).........)))).))..)))))))).)))))))..........(((((...))))).((((.....)))))))))).).))...)))...)))).)))))))).))))..))).(((........))).......)))))((((((....))))))....)).))..))))).)))).))))..))))..)))..).)))))))))...)))))((((((.((((.((((((....(((...(((((..((.(.((((......)))).).))))))))))..))))))....)))).))))))))))))..)))).............((((((((...))))))))..((....))...((((((((((......(((......)))....((((..((((.((((((......((((((.((((((...............))))))........))))))))))))))))..))))))))))))))...((((.....))))...))))))...((((((((((((....))))))))))))...((((((........)).))))...))))))........)))))))))).))))....)))))).(((((.((........)).))))))))))))...........))))))))))((((......)))))))))).....)))))))...).))))).)))))))......((((((.....((((.....))))(((((((((.((((....(((((((((.((((..(((((((((((........)))...........(((.(((((....))))).)))..(((((((((((((((.(..((((((.(((((((((((((((...(((((...(((((.........)))))...)).(((((.((....)).)))))...((((..((........))..)))))))...)))))))))))))))))))))((((((.......)))))).((.(((((....((((..((((....))))..))))))))))).........(((((.......)))))((((((...(((((..((((((...((((.......))))))))))......)))))...))))))..).)))))))))))......)))))))).))))))))..)))))))))......((((((.......))))))...)))))).)))))))..((((..(((.((.((.(((......))).)).)).)))..)))).........))))))...(((((......)))))(((((...)))))....)))).......................
Thermodynamic Ensemble Prediction
.{(((.(((({,{{,.,,{|||,{((({,.,,,,||..((((......))))..((((((((((((.((((((((.....(((((({{.......,,..((((((((.((((..(((({{{((.((((.....,..,,,(((({{...,.(((({.{(,.({({........))))...}}.))))),}....}),})}}))))))))))))....))))...)))))))).........(((({......}))))...((((((((((.(((((((.,{((((....)))),||....{((.{{.......,,.}},((((((((.....)))))))),,{{(((((({,(((((....)))))||,}}}},)},((((((((((.((((((..((((((....((....})....))))))..))))))..{(((((..((((({....((((...((((((.........,{{{.(,..(((((((((,,(((.((((..((((.((((.(((((.((.(((((((......)))))(((((((((.....))).)))))).....{.((((((((.,((((((((((.((....)).))..(((((.....)))))..))))}.,))).,)))))))).,........,,{{{((((((((((((((((((...(((,({{.((((({........(((((((.((((((((......)))))}}}})))))}.{(((((((({...|||..,..(((((..(((....))).)))))...|||{{{{({((.((((,..,....(((((...((..((((.{(((({...,{((|,{((({{...)))))}..}})}},...........(((((((((((.(..((((....))))...(((.((((.((.((((..((((((((((((((,,{,{{{(((({.,{|||||({({{(((.((((((((((((((((.(((..(((((...)))))..))).))).......))))))))),...}))).}})..}}|{((((((((((((.(((((..((((.....))))..))))))))))))))))))}|{{{,,||{{{{{{,,{{...{{{{,||,|||{{(({{.,,.||,,,,||.(((({((.,,,..}}}}}}}(({,.,,,..}|||,...{{,.,.,|||{(((({((((.....|||},|||}},....}}}}))).,|.,,.{(||||,,,,|||||.,||,,,,||}|(({({...{(((.,..}}}}..}}}})))},....,||(((((,.(({(,((({((({{..,},.|||||.,,.,|||||,..,..,{||,|}|||.||||{{{{{{{.|{{{,...,,|,...}}}}((((((......)))))).....{{{{{{,{{{{.......)))),.,}})))}))),..{((((((.......))))))}}|)}}},.}},,))},),...}}}}})))}))}})))}).)))))).,...}}}}}..........,{({.,((((((...,..,..(((((,{{(({...,,.....,,.{{{.{{{..((.(((....))),)|,{,,|||||..,{{{(,((,...((((((((((.........)))))))))).||||.....,}|||},||||....,...,,,,.))))},.}}}}}))).))}}.....}))))..})),})))))}))...))).,}}}}}}.}}}......}}}))))...,.}))))})},.,)),,,.))))))..)))).)).)))).))).{(.(((((((((((...........,((((((,,,(((((((((.({......)}...))))))))).||(((((....((((.((((((......(((.((((((((..,,..({{{((((((,.,,,{(({{{,.{{.....,||,..((((((.,...((.(((........))).))...,)))))),(((({.((((((...(((.((((((...)))))).))).)))))).,|.....,,..((((.((,...,}},.))))..}))))}.(((((.((......)).))))).....,,{,,,,|||{|.,....{((((.{|,{(({{(......))))}.....})).)))))))}}})})}))|,((((((((...))))).))).,{{{|.{|||{|.{||,,,)}).)})}).,)))))))))))))))))))).......))))...))))}.,|((((((.((((...(......)...)))))))))).))))))|(((((((((.{{..((...(((..((,{......(((....))).....,,..)),,)))..})})).))))))))),))))))))))).))).)))))))))))............)))))))))).)).))))).....,.}.}))).))}}}))}))}},))))))}.,,,.....}(((((...))))},((((.....)))))))))).},)}...}))...)))).)))))))).}}}}}})..,{(,...|,,..|||.......})))}{{{{{{..,,))))))....)).))..))))).)))).))))..))))..)))..).)))))))))...))}}}((((((.((({.((((((....(((...(((((,.{{.(.((((......)))).).))))))))))..))))))....}))}.))))))))))))..))))........,,,,.{(((((((...)))))))),}||.........((((((((((.{.,,.((....}}.))}....{(((..((((.((((((......((((((.((((((....,.....,....))))))........))))))))))))))))..)))}))))))))))...{(((.....))))...))))))...((((((((((((....))))))))))))...(((((({.....)})}.})))...))))))........)))))))))).,,}..}||}})}})}||{{|{(({{{.....,,}))))})))))))...........)))))))))),(((......)})))))))).....)))))))...).)))))))))))))........,(({,....{(((,..,,}}}|{((((((((.{(((,,,,(({{{{{((,((((..{(({,,{{{,.........)}}}}}}..,....(((.(((({....}}}}},|||,,(,,,{|||||||{||.|.,|||{((.((((((((((((((((,{((.((.,,(((((......,,{{{((,((((....}}}}.}}))).....,,,...,||,..,,.}}}}...})},))))))},,.,}))))))))))))),,,,}}{{((((...,,,.))))}}.|||||,|||||||{|{,.{(({|,|,||||||.,}}}|||}},.........{{(({,,..,,,}})}|{{|||,...{{{{,..{|{{||,}}|||{.......}}}}}}}}}}...,,,}},)}}},}}}))),,},}}})}}}}}}}......}}}))))},))})))))},))}))))}}...,..{{{(((.......)))))}...}}}}}|,}}}}))}..{{{{..{{{.,,.,.,{{{{,...|}))})},}},))),.))))||||..,}})))))),,|{{(({...,,.}}}}}|||||...))}}},,.,||||......}))))}}}),))))...

Transcripts

ID Sequence Length GC content
GAGUCCGUUUGAGGAAGUCCCCGAGGCGCACAGAGCAAGCCCACGCGAG… 3828 nt 0.4616
Summary

This gene encodes the coagulation factor XIII A subunit. Coagulation factor XIII is the last zymogen to become activated in the blood coagulation cascade. Plasma factor XIII is a heterotetramer composed of 2 A subunits and 2 B subunits. The A subunits have catalytic function, and the B subunits do not have enzymatic activity and may serve as plasma carrier molecules. Platelet factor XIII is comprised only of 2 A subunits, which are identical to those of plasma origin. Upon cleavage of the activation peptide by thrombin and in the presence of calcium ion, the plasma factor XIII dissociates its B subunits and yields the same active enzyme, factor XIIIa, as platelet factor XIII. This enzyme acts as a transglutaminase to catalyze the formation of gamma-glutamyl-epsilon-lysine crosslinking between fibrin molecules, thus stabilizing the fibrin clot. It also crosslinks alpha-2-plasmin inhibitor, or fibronectin, to the alpha chains of fibrin. Factor XIII deficiency is classified into two categories: type I deficiency, characterized by the lack of both the A and B subunits; and type II deficiency, characterized by the lack of the A subunit alone. These defects can result in a lifelong bleeding tendency, defective wound healing, and habitual abortion. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans analyzing heart tissue samples from patients with various structural heart diseases identified a 62-gene expression signature capable of distinguishing diseased from control samples with high accuracy [Fajarda et al. DOI:10.1186/s13040-020-00217-8].