Basic Information

Symbol
F2
RNA class
mRNA
Alias
Coagulation Factor II, Thrombin Prepro-Coagulation Factor II Prothrombin EC 3.4.21.5 Coagulation Factor II (Thrombin) Coagulation Factor II Prothrombin B-Chain Thrombin Factor II EC 3.4.21 RPRGL2 THPH1 PT
Location (GRCh38)
11:46719166-46739822
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Tissue/body fluid identification Mechanical injury analysis Chronological age estimation
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000506.5
Sequence length
1990.0 nt
GC content
0.5829

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-804.60 kcal/mol
Thermodynamic ensemble
Free energy: -839.05 kcal/mol
Frequency: 0.0000
Diversity: 601.63
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((((.((.......(((((((((((((((..((((.((((((....))))))..))))...((((..(((((((......))))))).)))).((((((((((.(((((((....((((..((..((((((((...((((.(((......((((((((...)))))))))))..))))...)))))))).))))))((((((((..(..(.((((.(((((....))))).)))))..)..))))))))((((.((((.....)))))))).....((((...))))...(((((.((..(((((.(((((.((.....)).))))).).))))..)).))))).(((((((((((.......(((.((..(((....)))..)))))((((((.(((.(((..(((.((......)).)))...))).)))))))))............))))).((((((((....))).)))))......(((.((......)).))).(((((((.((...))))))))).......)))))).....))))))).)))))))))).((((((((((((.(((((((....((((((......).))))).((((((((((.((....((.((((.....)))))))).))))))).)))(((((((....))))))).......((((((.((((....(((....)))..)))).))))))))))))).(((((.((......))...)))))...((..(((..((..(((((.(.(((((....)))))))))))..))..))).))....))))))))))))....))))))))((((((..((.((((((...)))))).))....))))))....(((((.(....))))))..)))))))....((..(((((((.((((((((.(((((((((((.(.((..(((.((.((((...((.((((((((.(((.(((.(.(((((((..((((((.........)))))).)))).))).).))))))(((((.(((........))).)))))....((......)).......(((((((((.(((((.((((..(((((.(........).))))))))).)).))).((((..((((((....)))))))))).....(((....)))))))))))))))).))))))...))))..)).))).)))))))))))))))))..)))))....)))))))..)))))))))).........)))).((.((((((((((((..((.(((((((((....(((((..((((((.(((........)))...((((.((((...))))....))))...((..((((((......)))).))..))))))))..)))))..)))))..))))..))...(((((((.(((((((.((((.....(((((.((((.(((((((.(((....))))))).....((((((((...))))))))..))).)))).)))))....)))))))))))....((((.((.(((.(.(((..(........).))).).))))).))))((((((.....))))))(((((.(((.(((((((((((....))))).((((((..(((.(((((((...(((..((.....))..)))...))..)))))...)))..)((((.(((((((((...(((..(((((((((.(.((((.....)))).).)))........))))))..)))..))))))))).))))...)))))..))))))..))).))))).......)))))))((((....))))(((((........)))))..))))))))))))..))......((((((.(((((((.(.........))))))))(((((((.....((...((((.(((....))).))))...))..)))))))...........)))))).....
Thermodynamic Ensemble Prediction
..,,.,((((({(({.,,.({((,(((((,((((((,.((((.((((((....))))))..))))|,,({((,,(((({((,,,,.,|}}}}}}{|}}|.{(({((((((.((((((,.,..{((({{((,{((((((((.,.((((.(((.,{,..((((((({...}))))))))))..))))..,)))))))}.,,}}}|((((((({,,(,.{.((((.(({((...,|||||.|||},,,|,,||}}}}}}{(((,((((,.,,.|||}||||,....(({,...}))}...(((({,({..(((((.(((((.((.....)).))))).),,)))..)).))))).(((((((((((.....}|||{.(({.{((,,..}}}..)}}|||{.(((.({{,|||,|{(({(((..((.{...},.)),.)})}})),})...,,,,.,,.....{{{,,,,|||||,,,,)),.|||||....,}}}|.||,...,,},.,,|.(((((((.((...)))))))))......)))))))..,,.}}}))||,||||}|||},.|||{|||||||{|||||{|||.,,.|||,||}}||}|,|}}}}}}}|}}},|||,||||||{{|||{{....,)),)})))))))))))}}},(((((((....))))))){{{{{{{((((((.(((({...(((....))).,)))).)))))((((((((((.((....)).)))))),,)))|,.,.|,.,((({{(|,.((((,.{,(((((....)))))))))))..}}|||}||,|,.{{|,,,,)))),)).}}.)))}}),)||||||..((.((((((...)))))).))....))))))}}..(((({,(....)))))).}))))))}..}}||}},||||||,|{||||||.|||||,||{|{.|}||}}|||,,..||||}}.,|}|||,,|||}.||.((({({(.(((((..,{{|||},.,.,,,,||||||{((((((|...,{{|||,((({(,(((........})).))))),||.{{......}}.......(((((((((..,,((.((((..(((((.(........).))))))))).}}.||,.((({.,((((((....))))))))))..}}.{{{....))))))))))))||}|{|,|||,{{{||,||,,,.,))},,)))))})))})))})}.)))))}}}})))}|||.{||},,,})))})}......}}.},||,((((((((((((..((.(((((((((....(((((..((((((.,,,........|}|...,{,,.{{{|.,.}}}}....,})}...((..((((((......)))).))..)}))))))..)))))..)))))..))))..))...((((((({((((,,.((((({,...(((((.(((({(((((((.(((....)))))))..,..((((((((...)))))))),,})}.}))}.)))))...,||}||}}||||{{{.((((.((.(((.{.(((..(........}.))).}.))))).)))),|||||..,..}))}))|{,,({(((,{((({{(((((....))))}.{,,||},.||}}||}}}}}}}}}}}}.,{{{{{{,((((({{{,,{(((......,,.....((((.(((((((((...(((,.(((((((((.(.((((.....)))).)})))........}))))).,)))..))))))))).))))...,,,},.}))))))}})))},))))),.....)))))))((((....))))(((((........)))))..))))))))))))..,,}}}}}}|((((({{(((.,,.}}}.,}}}}),)))))))||,{{{,....{((...(((,{((({{{{||}.,}||,..,,..))),,,}..,}}}}}}}}),)))}.})}.

Transcripts

ID Sequence Length GC content
NM_000506.5 NCBI
AGUGACCCAGGAGCUGACACACUAUGGCGCACGUCCGAGGCUUGCAGCU… 1990 nt 0.5829
Summary

This gene encodes the prothrombin protein (also known as coagulation factor II ). This protein is proteolytically cleaved in multiple steps to form the activated serine protease thrombin. The activated thrombin enzyme plays an important role in thrombosis and hemostasis by converting fibrinogen to fibrin during blood clot formation, by stimulating platelet aggregation, and by activating additional coagulation factor s. Thrombin also plays a role in cell proliferation, tissue repair, and angiogenesis as well as maintaining vascular integrity during development and postnatal life. Peptides derived from the C-terminus of this protein have antimicrobial activity against E. coli and P. aeruginosa. Mutations in this gene lead to various forms of thrombosis and dysprothrombinemia. Rapid increases in cytokine levels following coronavirus infections can dysregulate the coagulation cascade and produce thrombosis, compromised blood supply, and organ failure. [provided by RefSeq, May 2020]

Forensic Context

A study in human cadavers demonstrated that the F2 gene, used as one of eight liver-specific biomarkers in a targeted RNA massively parallel sequencing assay, showed expression that ceased after approximately four days postmortem, with the assay successfully identifying liver tissue in all 27 analyzed samples with 98–100% of reads mapping to the liver biomarkers [Javan et al. DOI:10.1038/s41598-020-63727-9]. In a separate study in rats, the F2 gene was identified as significantly altered in expression on day 1 following a 20% total body surface area burn injury, indicating its involvement in the hepatic inflammatory response [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025]. A study in human blood plasma demonstrated that the F2 (prothrombin) was significantly downregulated with age and was used as part of a 21-protein panel to build chronological age-predictive models [Salignon et al. DOI:10.18632/aging.204787]. The protein-based model achieved an R² of 0.59 ± 0.02, and combining this proteomic data with miRNA data significantly improved prediction accuracy to an R² of 0.70 ± 0.01, capturing a broader range of age-related physiological changes.