Basic Information

Symbol
F2RL1
RNA class
mRNA
Alias
F2R Like Trypsin Receptor 1 PAR2 GPR11 Coagulation Factor II (Thrombin) Receptor-Like 1 Proteinase-Activated Receptor 2 G-Protein Coupled Receptor 11 Thrombin Receptor-Like 1 Coagulation Factor II Receptor-Like 1 Proteinase-Activated Receptor-2 Protease-Activated Receptor 2 PAR-2
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Wound age identification

MANE select

Transcript ID
NM_005242.6
Sequence length
2861.0 nt
GC content
0.4408

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-860.10 kcal/mol
Thermodynamic ensemble
Free energy: -910.56 kcal/mol
Frequency: 0.0000
Diversity: 803.98
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((....(((.(((((((((((.(.(......).).))))...))))))).)))(((((.....))))).(((((.((.(((...))))).)))))....(((((((((((...(((..((((((((.....))).)))))..)))((.(((((((((..(((((((((......)).))))))).))).)))))).))....((((.(((.(((((.((((.(.(((((((.((((((((..(((......(((((((((((((((....)))))))((((..........))))...((((((((.(((........)))..))))))))((((.(.((((((((...............)))))))).)))))..)))))))).(((((((....))))))).....(.((.(((((.((((((...(((..(((((.((((((((..((((((........))))))((((...))))..)))))))).)))))..)))..)))))).))))))).)...)))..)))))))).........(((((............)))))....)))))..((((((((((.(........).)))).............((((.((((.....))))))))..((...((((((((((((........)))))...)))))))...)).))))))))).)))).))))))))))))....(((((((..((......)))))))))...))))))))))).(((((((...(((((((((.(((..(((..((((.....((((((((...(((..(((.((((...((((..((((.....(((((((((((((((((((((((..((.....))..)))))(((((((((((.(((((((((((((((((((...((((((......(((((.(((((.((.((.((((..........)))).)).))))))).........)))))......)))))).)))..................(((((.(.(((((.(..((((((((((((.((((((((((..(((((...(((.(((((....((((.....)))).((((((.(((......)))..)))))).....((((((.......................))))))..((((..((((..........((((((...(((....(((((((.((((........(((.((((((...((((....)))))))))).))))))).).))))))....)))..))))))...((((...((((..(((((((.....(((((..((((((....(((((...............)))))..))).))))))))....)))))))..)))).))))............((((.(((.....))).))))...))))..))))...((((((...))))))))))).)))....))))))))))))))).......(((((...((.........))...))))).....(((((.((((.......((((........)))).....)))).))))).......))))))))....)))).).))))).).)))))..(((.(((.((((.....))))..))).)))((((....)))).((((((.(((((.(((((((((....))))))))).))).)).))))))....))))))......))))))))))))))...))))).))(((((...)))))....(((((....)))))..))))).......))))))).....)))))).....))))))))..))))))))))((((((((............))))))))))))))))...))))..)))..)))))).......((((((((.(((.(((..(((((((.(((.....((((((....)))))))))))))))).))).))).))))))))))))))....))))))).((((.(((((((((((((...((((.((((.......(((((((((((.((((.((((.((((.(((((.(((((..((..(((((....)))))..))..((((((((((((((((...((..((((((((.(((.(((((........)))))))).)))).))))))...))))))))....................((((((.((.......)))))))))))).))))....((((((((((((((((((.......)))))((((((.(((((((.((((((....)).)))).))).)))).))))))....(((((((((........((((((..(((..(((((............))))).)))..)))))))))))))))(((.((..((.((.((((..(((........)))..)))))).))..)))))...(((....)))...........))))))))))))).((((((.............))))))....))))).))))).))))..)))).)))).)).)))))))))..((((....((((...))))...))))..))))..)))).))))))))).........((....)).....((((((((...(((((..(((((((.(((((.......(((((((....((((........))))....))))))).(((((((((..((.....)).)))))))))))))).))..))))))))))..))))))))))))))))..........((((((...))))))((((....((((.((((((((((........)))))).)))).))))..))))......))))........
Thermodynamic Ensemble Prediction
,{,,....{((.(({{(((({{({({(.,,,,.|,|{}|||,.,|||||||,||}((((((.....,.})}|||(({({.{(({{{|||||,,}}))}}}}(((((((((((.{.(((..((((((((.....))).)))))..)))((.(((((((((..(((((((((......)).))))))).)))},))))).))....((((.(((.(((((.((((.(.((((,,,.(((((((({({({...,,.,{(((((({((({{{....}}}}}}|(((({,.....,,,||}||.,((({((((,({{,(,,,.|.,}|,,|}|||||}((((,(,((({{{{{|,.,,.|,...,}..)))))))),})))),,)})))))),|{(((({....}))))}),,..,|,|{.(((((.((((((...(((..(((((.((((((((,{((((((........))))))|(({...,))}..)))))))).)))))..)))..)))))).)))))}}....,}}},,)}}}||||,{.,{,,,.(((((............)))))....,}},},,|{||||||{{.....,,...,,))},...)))}},,,,,{{{{.{{{|..,,,))))))}}...,.,,((((((((((((........)))))...))))))).,.)),}}}}))))).)))).))))))))))))....(((((((..((.....,),))))))).,.))))))))))).|||||{||||,,.,,...{,|||,,|||||||||,....},,}|{{|||||||||{((((((.((....)).))))))}..((((((((((((((((((((((((...({......})....}})))){((({.{(((({.{.....).})))}},((((((......(((((.(((((.((.((.((((,,....,,..)))).)).))))))).........)))))......)))))).|))}}}....,{,,,,{{{,.(((((.(.(((((.{..((((((((((((.((((((((((..(((((...(((.(((({....{(((.....)))}.((((((.(((......)))..)))))).....((((((.....,.................)))))}..((({..{{{{,.........((((((...(((....(((((((.((((........(((.((((((...((((....)))))))))).))))))).).))))))....)))..)))))}...((((...((((..(((((((...,,(((((..((((((....(((((...,...........)))))..))).)))))))),...)))))))..)))).))))..........,,{{((.{{{...,.)}}.}}})...))}}..))))...((((((...))))))))))).)))....))))))))))))))),,,...,{,,,,,..||}........,..............(((((.((((..{{,..{(((........))))},...)))).))))).......))))))))....)))).}.))))).).)))))..(((.(((.((((.....))))..))).)))((((....)))).((((((.(((((.(((((((((....))))))))).))).)).))))))...,||,,,.{,{,..((((((....)))))).,}}}.,|.(((((...))))).,..{{{{{....})))}..)))))||.....|}))))).....)))))),{((({{,.{{....)),,))))))|{((((((...{,...,}..))))))}|((((((((({.,{{{.,|,,,||||,,...,,,}})}},}}||||||}|||..(((((((.(((,....{((((,....}))))))))))))))).|}}.,|.{,(((({({{{{.{||,,,)}),.,))})}}},}}}|})}}}}}})))}.))),||,.....{(((((.((..((((......})))..|}.|))))},((({{(({.(((((....)))))..,,..,,,,((((((((((({...{{..((((((((.(({{(((((........)))))))).)))).))))}).,.)))))))}....................(((((,,((.......))))))))||||,,}},.....||||,|||||}}|||||,.}},}})}}))|||((({(((({((...(((.....))).,.},),)}))))})},,||{((((({{{{|||,,.,...,|{|{{{..{{{..((((({.....,,,.|.}}},,,|||,,|}}}|}}}}}})))).))))|,,|..,,{((((..(((........)))..)))))}.))},))))},,,|{,....}}}.,.....,{{|||||||}||||||,((((((.,{.,......|,|||}|,....)})))}),,,,.,}}},|}|}|,{{|||||{|,,,,,|,{({(((,..{{((({....,},{.{|,{((((({..{{{{....))))..))))))}.,},|..{{|,{{...(((((((({,.{{,,,.,|,|||}|}||||,..,}.,,|{{,{{|}}}}|,||}}}}..}})))),,,}))))))}.|||||||||},((,..,,}|{|||||}}}}{||||,||,.}))),))))),}))))),,,,}.}}})}},,},.,...||||||...}})}||{{{{,,..{,{{,{{{(((({{{...,,,.,}}}}}},,,))})))),.)})},,,,.,,}}}........

Transcripts

ID Sequence Length GC content
GAAACCUAACCCGCCCUGGGGAGGCGCGCAGCAGAGGCUCCGAUUCGGG… 2861 nt 0.4408
Summary

This gene encodes a member of the G-protein coupled receptor 1 family of proteins. The encoded cell surface receptor is activated through proteolytic cleavage of its extracellular amino terminus, resulting in a new amino terminus that acts as a tethered ligand that binds to an extracellular loop domain. Activation of the receptor has been shown to stimulate vascular smooth muscle relaxation, dilate blood vessels, increase blood flow, and lower blood pressure. This protein is also important in the inflammatory response, as well as innate and adaptive immunity. [provided by RefSeq, Jun 2016]

Forensic Context

A study in rhesus macaques identified the F2RL1 as a shared upregulated differentially expressed gene between rhesus and pediatric/adult human hypertrophic cardiomyopathy [Rivas et al. DOI:10.1038/s41598-024-82770-4], while separate research in human chronic wound inflammation indicated increased melanocytes in pressure sore wounds may promote inflammation through the cathepsin G-F2RL1 interaction as part of the PARs signaling pathway [Cheng et al. DOI:10.1093/burnst/tkae043].