Basic Information

Symbol
F2RL3
RNA class
mRNA
Alias
F2R Like Thrombin Or Trypsin Receptor 3 PAR4 Coagulation Factor II (Thrombin) Receptor-Like 3 F2R Like Thrombin/Trypsin Receptor 3 Proteinase-Activated Receptor 4 Thrombin Receptor-Like 3 PAR-4 Coagulation Factor II Receptor-Like 3 Proteinase-Activated Receptor-4 Protease-Activated Receptor-4
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Cause of death analysis

MANE select

Transcript ID
NM_003950.4
Sequence length
3334.0 nt
GC content
0.6092

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1491.00 kcal/mol
Thermodynamic ensemble
Free energy: -1546.62 kcal/mol
Frequency: 0.0000
Diversity: 629.77
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((.(((((..((((((((((((((((.((((.((((((.((((((((((((((((((((((((((....((((((........))))).)....))))))....(((((((((.....)))))))))((((((.((((((((((((.(((((((.((((.(((((((((((((((((.(.((.(((....((((((.((.......)).))))))...(((((((........((((((......)))))))))))))(((...))).....(((((((.((((.((((....((.(((((((..((....((((...(((......)))....))))...))..)))))...)).))....)))))))).)))))))))).)).).)))))..))).))))))))).).)))...))))))((.(((.((((.....)))).)))))((((((.(((((.(((((((....)))))))((((.(((((((.((...)).))))))))))).))))))))))).(((((.((......)))))))).))).))))..)))))))))))..))))))))))))...))))))))((((...(((((....)))))...))))..)))))).))))((..(((((((((.(((((....(((((......))))).))))).)))).))))))).)))))))))..((.((((((..((((((((((.((((.((((((....)))).))))))((((.(((((((((((....(((....(((((((........)))))))((((((((..(((((((....((((((.(((((((((((((((.(((((((.......)))))))..)))....((((((..((((((((((.(((........)))))...(((((..(((.......((((((((((((........))).(((((((((..((((((((((...(((....))).))))).)).))))))))))))..(((((...(((((((.((.((((((.(((.....)))...)))))).)))))))))......)))))(((((...))))).(((....)))....(((....)))(((((((...))))))).........(((((.((.(((((......))))))).)))))..))))))).))((((((......))))))......)))..))))).))))))))....)))))))).)))).)))......((..((((.((....)).))))..))...))).))))))..)))))))))))))))..(((((((.((((((((..(((..(((((((..((((((((((((.....(((.......)))....)))).))))))))...(((((....))))).......((((((((((((....)))))))))...)))..))))))))))))))).(((.((((((((((.....)))).).))))).))))))))))))).....)))....))).))))))))))))((((((((((((((..((((((...((((((.((((.((((((.(((((..((((....)))).)))))...)).))))(((....((((.......)))))))..................((((((((.(((..(((....)))..))).))))))))(((((....)))))......)).)).)))))).)))))).)))).....)).)))))))).....((((..((((...))))...))))(((((((((...((((.......((((((((((.....)))))).))))......))))((((((.(((((((((((((((((((((((((((....((((((....))))))((((........(..((((((...(((.((((..(((((((..(((((....).)))).)).))))).))))..........................(((((((((((((....))).)))))....(((........))).(((((..(((.....)))..)))))((((((.(((((.(((((.(....).)))))))))).)).)))).))))))))....))))))..)((((((((............................).))))))).(((.((((((((((....)))))))))).)))((((....))))..))))((((((((.(..(((((((.(((((((.(((...)))...)))))))..)).)))))..))))))))).......................)))))))(.(((((((((((.(.....).)))))))))))))))))))).((((((.(((((.(.....((((((....(((((..((((.(((.((.(((......))).))))).))))..)))))...)))))).....)))))).))))))............(((((((.(((....(((...........((((((((.(((....)))(((.((((((((..(((..((.(......).)).))).((((.((((((.((((((.(((..((...(((...((((.(((((((.(.((((..(((.(.(((((.((((((..........))))))...)))))).)))....)))).)))))).)).)))).))).(((((.((((((........)))))).)))))..))))).)))))))))))))))).....(((((((((((((.(.((.............)).).)))))))))..))))..)))))))).)))))))))))((((((....))))))..(((((....)))))...((((((...(((((.((((.(((((.(((((((..(((...((((......(((((.(((..((((((((.((((((..........)))))).(((..((((((..(((((((.....))))))).))))))...)))......)))))))))))...)))))......))))...))))))).))).))))).)))))))))......))))))..(((((.(((...)))...)))))(((((........)))))..)))....)))))))))))))))...))))).))...)))))).)))))))))..)).))))))))...))))))))...))))))))))))))))...((.(((.(((((((((((((((.......)))).))))))))..(((((((....)))))))..((((...)))).....))).))).))...
Thermodynamic Ensemble Prediction
...((((.(((((..((((((((((((((((,((((.((((((.((((((((((((((((((((((((((....{(((((........))))).}.,..))))))....(((((((((.....))))))))){(((((.((((((((((((.{((((((.((({.(((((((((((((((((.(.((.(((....((((((.((.......)).))))))|,{(((((((........((((((......)))))))))))))|{{...,,,.....(((((((.((((.((((....((.(((((((..({....((((...(((......)))....))))...})..)))))...)).))....)))))))).)))))))))).)).).)))))..)))}})))))))).}.)))...))))))((.(((.((((.....)))).)))))((((((.(((((.(((((((....)))))))((((.(((((((.((...)).))))))))))).))))))))))).(((((.({......)))))))}.))).))))..))))))))))}..)))))))))))),..})))))))((((.{.(((((....)))))...)))),.)))))).))))|..,(((((((((.(((((....(((({......))))}.))))).)))).)))))}..)))))))))..((.((((((..((((((((((,,{{{.(({((({{{{||,,.)))}))||{|}(((((((((((....{((....(((((((........)))))))((((((((.,(((((((....((((((.((({{.{(.,{.(((.(((((((.......))))))},,|||..,.{{{{|{||((((({{(((.{(({..,....|||||..,(((((..{{(,,,(({(((((((,,((((....,,,.||||(((((((((..((((((((((...(((....))).))))).)).)))))))))))).,(((((...(((((((.((.(((((({((({....))).,.)))))).)))))))))......}}||}(((((...,}})).||{.|,.))}...,(((|...}|}|((((({...)))))))..,,.....|||{{,,,.(((((......)))))}).))))}.....}}},.|,((((((......))))))......))),}))))),))}})))).}..))))))))))))},.,.,,,..}||,.||||}||},..}}.}|}},,}}.})))).))))))..)))))))))))))))..((((((({((({{((({{(((..(((((((..((((((((((((.....(((.......)))....)))))))))))))...(((((....))))).......,{{(((((((((....))))))))}...}},..))))))))))))))).(((.{(((({((((.....)))).}.))))).))))))))))))).....}))....))).))))))))||||,({{....))),.....{{{{||..,,...}.}||,.{|||{(.((({,..{(((.,,.}}}}.))))}...)).))))|,))....(((((............))))}.............,{||||||.{{({{(((,,,.|}}..,,,.)))))))))|||||{({.(((((.((((((((((((((....(((((((.((.(((((((((((((({.......(((((((.(({,..(((...{.(((((.....))))).}((((((((((....))))))))))..,,..,{{,.........,},.,)},.)))..))).))))))){(((((((((.(((((..{,,(((((....)),}}}}}{(((.((((((...(((,(({{..((((((,.{(((((....,.|}||{||.}}})},)))).......{{{,....}}},..,}..}|||||,,{({(((....))).})}))}}},(((........))).(((((..(((.....)))..)))))((((((.(((({,(((((.{....}.)))))))))).)).)))).})))))))....))))))..)))|(((({............................}.}))),.))))).)))))))))}}))))))}..,)))))))..........(((((({{(((({(({({{{,{.{|||,,.,|{{|.{{{|...((((((((((((((..(((((,.........},,))))............)))))))))).)))){{{|{||{|||,,.,...).))))))))))|{{|}..)))|((((((((((((..,{(,.((((((...(((,,,((((((((,.{(((((({.(......),)),,}))))})))).})))))).....))))))|))|.(((((...............))))}.....,..((((((.(((...{(((((((.{((....))}(((.((((((((...(({.(,,....,.,)})..,}}.{(((.((((((,{(((((.((,.,((...,,{...{{{(.(((((((,(.((((..(((,{.(((((.((((((..........))))))...)))))}.))}...,)},}.}))))).)),)))).}))}(((((.((((((........)))))).)))))..))))).)))))))))))))))),.,,,((({(((((((((.{.,...,,||.......}}.}.))))))))).,))))..)))))))).))))))))))|((((((....))))))..,...,.)))))))))..((((((..,(((((.((((.(((((.((((({,.{(((...((((......(((((.(((,,((((((((.((((((..........)))))).{{(..((((((..(((((((.....))))))).))))))...))}......)))))))))))...)))))......))))...))))})).))).))))).)))))))))......))))))........)))))))))))),....(((((........))))).))))))))))))))))))))....))))).)))))))))))))).}}))}},...}).))))))))...))))))))...))))))))))))))))...((.(((.(((((((((((((((.......))))}))))))))..(((((((....))))))),,{(({,,,|}}}.,}},)}).})).)),..

Transcripts

ID Sequence Length GC content
AACCCACACUCCAGUCCUCCCACGGGCUGGCUGGCAAGCGGCCCUGGUG… 3334 nt 0.6092
Summary

This gene encodes a member of the protease-activated receptor subfamily, part of the G-protein coupled receptor 1 family of proteins. The encoded receptor is proteolytically processed to reveal an extracellular N-terminal tethered ligand that binds to and activates the receptor. This receptor plays a role in blood coagulation, inflammation and response to pain. Hypomethylation at this gene may be associated with lung cancer in human patients. [provided by RefSeq, Sep 2016]

Forensic Context

A study in rhesus macaques identified the F2RL3 as a shared upregulated differentially expressed gene between rhesus and pediatric human hypertrophic cardiomyopathy [Rivas et al. DOI:10.1038/s41598-024-82770-4]. In human sepsis patients, post-mortem transcriptome analysis found the F2RL3 was downregulated in the kidneys as part of the haemostasis pathway [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].