Basic Information

Symbol
F8
RNA class
mRNA
Alias
Coagulation Factor VIII DXS1253E FVIII HEMA F8C Coagulation Factor VIII, Procoagulant Component Antihemophilic Factor AHF Coagulation Factor VIII A1 Domain Coagulation Factor VIII C2 Domain Coagulation Factor VIIIc Procoagulant Component Factor VIII F8B Factor VIIIF8B Hemophilia A THPH13 F8B
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_000132.4
Sequence length
9032.0 nt
GC content
0.4160

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2435.10 kcal/mol
Thermodynamic ensemble
Free energy: -2605.06 kcal/mol
Frequency: 0.0000
Diversity: 2632.24
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.(((((((.....((((((((.((((((((......(((...)))........))))))))...........((((.........))))(((....)))..(((((.....)))))(((((.......)))))(((..((((..((((((((((.((.(((((((((.(.(((.((((...(((((..((((((((((((((..((((.((.(((((.....(((((..(((((((.......((((.((((((((.((.((((......)))))).......((((((((((((((..(((.((..((((((((..((.(((((((((...(((((((.((((.((...((((((((((((((.((...)).)))))).....))))(((..(((((((.((((.((((.(....(((...((..((((((((((.((((((.(((((((((.(.(((((..((((((((((((((((..............(((((((((((((.((((((((((((.(((.((((((.....))))))..)))...)))))..)))).))).)))).....(((((.....((((((...............)))))))))))))))))))).....(.(((..(((...)))..))).)..((((....))))..))).))))))))..........)))))....)))))).))))..)))))...))))))....)))))).)))))).)))...))))))))).)))))))..)))((..(((((............)))))..)).................))))....)).)))).)))))))))))))))))).....(((.....)))(((((((.((....)).))))))).....(((((((((......(((((.((.....))..........((((....((((...((((((((.((((((..(((......)))..)))))).))))))))...)))).....))))..))))).......(((((((((((.........)))).))))))).....)))))))..))..)))))))))))))....((((((...(((((.......((((.((((.((((((((((((((((((...(((.((((...(((((..(((......)))...)))))..)))).))))))))).))))))))).)))...))...................)).)))))))))(((((((((((((((((...(((((.........((((((((..(((((.((.((((((.......((((((....((((.((((((.((..((((...............(((.((((((......)).)))).)))..(((((((((((......))))..))))))).......(((((....))))).....((((...))))....)))).)).)))))))))).)))))).........(((........)))....((((((...(((((......((.(((((((.....((((((....(((..((((((((((........(((...((((((.......(((((((((.........))))).....)))).........(((((...((.((((..(((((...((((((((((((....))))).)))((((....))))......(((((((...((((((..........))))))...)))))))......))))))))))))))).)))))..))))))...)))((((((((((.....))).(((..((((((((((..(((.....((((((((..((((((((.(..((((((((.(((((....((((((............))))))...)))))...))....((((.((((.((.((((......)))).)).)))))))).))))))..).))))))))...(((...)))...........))))))))..)))..)))))))))).)))..))))))).)).))))))))..)))....))))))......((((((((..((((((((.((((((((((((((((.(((((....))))).))))).)))).....((((((...))))))..))))))).((((.(..((((((((.....((((......)))).........((((((....)))).)).(((((...((((((((..(((((((.....))))).))..)))))....((((((((....)).)))))).((.(((((((.((((((((((....(((((......))))).))))))))))..))))))).)).)))....))))).......))))))))..).))))....(((((((....)))))))))))))))..)))))))).(((.((((((..((((((.........(((((........((((............)))).(((.((((((((.((((.((.(((((.((((.((((...)))).(((...((.....)).)))..............)))).))))))).))))......((....))..(((((.(((.((((((..((((((((((((((...((((((.(((............(((...((((.((.((((.....)))).)).)))).)))..........((((......))))((((.(((((((.((.((((((((((((((((..(((((((((..((((...))))...........(((((.((((..((((((.(((..((((..((((...)))).((((((((.......)))))))).......(((((..((((((............))))))..))))))))).(((.(((.........))).)))..((....))..)).).))))))..))))..)))))...))))))))).......((((.....))))..)))))..))))....))))))).)).)).)))))))))..........((((((.((....)).))))))((((........)))).......))).))))))...........((((((((.....((((((((.......(((.......)))...))))))))))))))))....(((...(((....(((((((((((((...((((((.......))))))...................((((((.......(((.(((((((((...(((........))).....).)))))))).))).......))))))...(((.((((...........)))).))).((((.(((((((........))))))))))).))))))..))))))))))...)))..((((((((.....((.((((((.........((((.....)))).........((((((((((.((((((.((((.((......(((((....((.((((.(((((((((..((((((........)))))).((((((.(((((((((.(((......))).))).....((((...))))..)))).......)).)))))).......((((....))))((((((((.((((....((((((.............(((.(((((((..(((((((((((((...(.(.(((..((((((((((.((((((((..............(((((((((.....(((((((..(((.(.(((...............))).)...)))..)))))))))))))))).......(((........)))..((((...((((...(((..((.(((.....))).)))))))))....))))..)))))))).))))))..))))..))).))....)))))...)))))).....(((((....)))))......(((.(((..((((((.(((((((.((((..........................((.((((((..........))))))))...........((((((.........))))))...((((.((.(((..(((..((......((((....)))).......))..)))....))).))..))))..((((..(.(((.((((((....)))))))))).)))).(((........))).......((((.((((.((.(((....))).)))))).)))).......)))).)))))))....(((....))).....((((((....(((((...(((((..(((.......)))..))))).......(((.(((((..((((.((......)).))))..((((..................)))).)))))))).)))))....)))))).))))))...))))))))....))))))))))))))))...)))).))))))))..))))))))).)))).)).....)))))(((((((((((.......)))))).((.(((((((.........((((((((((.(((((((((....))))).....))))....))))))))))))))))).))(((.(((((.............((........)).....((((((...))))))..........))))))))......(((((.(((..((((((.........))))))..))).))))).)))))..((((....))))..........((((....))))...)).)))).))))))))).)))))))(((((.....((((((((........((..((.......))..)).......)))))))))))))((((.....((((....)))).....))))..(((((....)))))((((((((((((((((..(((((.(((((......))))).......)))))..))))))))((((((..............))))))...........(((((((((((((((.(..((((....)))).....(((....)))........).)))))))))))..(((((..............))))).......)))).(((((((((((((((...........)).)))))))............(((((......)))))........))))))....))))))))((((((.((((.......))))))))))...)))))).))......))))))))....))))))))).........)))))..(((((..............................))))).))))))))))))))........(((((.(((((....((((((((........(((((.((((.(((..(((((............((((((((....(((.........(((((....((((((((.((.((((((((..((((..((((((....))))))..))))..))......)))))).)).).)).)))))....))))))))))))))))...(((((((((((.((((....((((...........((((((.....))))))((.(((((((((((((..................)))))).(((((((.........(((((((.((((((...((((...........))))...)))))).)))))))............)))))))....))))))).)).....))))...)))).).....))))))))))(((((......)))))...)))))..))).)))).)))))(((((.(((((...((((....(((((.......)))))...))))..))))).)))))((((.....))))....(((((((...(((((.((((..((((((....)))))).((((((.(((((((......((((...))))........))))))).......(((....)))..)))))).....(((((((.......))).))))......((((....(.((..(((((((...)))))))..)).)....)))).)))).))))))))))))))))))))((((((((.((((((..(((((.(((((.........)))))..))))).........))))))..))))))))...))))))))))....))))))))))).)))))....(((.....))).(((((....)))))((((.....((((((.(((((.....))).)).)))))).....))))))))))..)))))))))........................))))))).))..(((..((.(((.((((........))))..)))))..)))(((((............)))))...((((((((....))))))))...)))))..)))))).((((((..(((....))).((........))...)))))).)))).....)))).))))))))))))).)))))..)))))))).)))))))))...))))))....))))).)))))))))....))))))))..)))).....))))))).)))))..))))).))....(((.(((((........))))).)))......(((((((...(((.(((((((.((..((((((......((....)).((.......))...))))))(((((((((((((.....)))))))))...)))))).)))))))..))).))))))).)))).)))))))..((((((.........(((((..(((((((...((((((((((((.......((...(((...(((((...))))))))...))..)))))))..)))))............((((((.(((...(((((((.((........)).))))).))...))).))))))(((((......))))).......)))))))..)))))((((........)))))))))).)))).))).....)))))..)))).))).)((((((.((((((((.((((..((((((((((.((((((...((((...((.(((.(((((.((..(((...(..(((((((..((((..................((((((((((((((.........(((((((((((((((((.(((....))).)))))))))))..(((((((((....((((...))))....)))).).))))....))))))(((.((((((((((((((.....)).................(((((.....))))))))))))))))).)))((((((...............(((((.((((.....)))).))))))))))))))))))))))))).................((((((.(((((((((...((((..(((((..(((((.......((((((....((((.(((.((((((((((......)))......(((((....)))))..(((((((...((((.(((((((((((((((....(((.(((((....((((............(((((.((((((.......))).))).))))).............(((((.((((((..((((((((((...((((((........)))))))))))))..)))....)))).)).)))))..))))....))))).)))....))))))..)))))).))).............((((......)))).......(((((.....((((.......((((((((..((((((.(.(((((.((((((((..(((((...(((..(((((((...)))))))..))).)))))...))))))......))))))).)..((((((..(((((((.((..(((((((....))))))).....))))))))).....)))))).(((((((((((........)))))........(((((((((((((((...(((((((.....(((......))))))))))))))))))))..)))))))))))..........))))))))))))))......)))))))))..........(((((((....)))))))..(((...))).))))..)))))))..(((((...(((((.((((..........))))...)))))....)))))......(((((((((.(((.......................))))))))))))......(.((((.........)))))..(((.(((((((..........(((((.((((((...((((...((((((...((((.............)))).....))))))..)))).((....)))))).)).)))))..........))))))))))))))).)).)))))))....)))))).((((((.(((((.......(((......)))))))).))))))..)))))..)))))..))))...))))))))).))))))..((((((((...((....(((((((.((.....))((.(((((.................))))))).....((((((((...............))))))))...((.(((.((((....)))).))).))))).))))....))...))))))))..........)))).)))..))))..)..................(((((.((............))))))).....(((........)))(((((....((((((............))))))....))))).)))..))))))).))).))...))))...)))))))))))))((((....)))).))).)))))))))))).))))))........)))))...........)))).))))))))))))))))...)))...........))))))))....))))))).))))).........................
Thermodynamic Ensemble Prediction
(((((.(((((((.....((((((((.((((((((....,,(,,,,,},,.,,,.,,,)))))))}.,.........{{{{.....,{{{.|{{((,....)))}},,||||...,}}},|(((((,,.....,,,)},||}}||{{..((((((((((.{(,(,,,.,,,,||}{{({((((,..{(((,{{({{{(((((((((((,{{{(((..,{{||.,,|,{||{{.,||||{{,.,.....{|{{,|||||||{.,({((((,{{...,||||,.,||{{{((((((((((((((.,(((.{(..((((((((..{{.(((((((((...(((((((.{(((.((...{(({,{{,{(((({.((...}}.}}}})).,...,.{((((..(((((((.((((.((((,({{,,((({..((((((((({,{{,..,||,|...}}}}}}})).{{(({{.,{{({({{{(((||||...,.,,.......(((((((((((((.{{((((((((((.(((.{{((({...,.}})})}..)))...))))),,))))},}}.)))).....(((((.....(((({{..,,{,,,......,)))))))))))))))))))).....,{(((,.(((,,,|||,.|||,|,,((({....||||..||},,})}})})}}......,,,}}}.,,,,},}}}.,,)))))))}}...}))),},...,}}})}||,..,}),},},,.,)))))))).)))))))..))))}{.{((((............)))))}.},...........,..,,,)})).,..)).)))).))))))))))))))))}}.....,,,....,|},(((((((.((....)).))))))).....{{(((((((......(((((,((.....,,,...}}}...{(({....{(((...((((((((.((((((..(((......)))..)))))).))))))))...)))).....})))..))))}.......{(((((({(((.........}))).))))))}.....))))))).,},..))))))))})))}.,..((((((...((((({,,....,{{{|{{((.((((((((((((((((((...(((.((((...(((((..(((......)))...)))))..)))).))))))))).)))))))))})))..,},,,........,........,,.,|}|}))))(((((((((((((((({...{{(((..,,,,...((((((((,,(((((,({{{{{{{{.......((((((....(({{{((((((.((..((((.......,,{,....{((.((((({......)).)))).))}.,(((((((((((......))))..))))))).......(((((....)))))....{(((,...,))}.,..)))).)).)))))))))).)))))).........{{{{,,,,..{{|{...,{{{{|{,..,{{{,...,..{{.((({{{{.,,,.((((((....(((..(((((((({{,.......,||,,.((((((.......{((((((((.........))))),.,,.}}}}.,,......(((((...{(,((((..(((({..,((((((((((((....))))).},,((((....))))......(((((((...((((((..........))))))...)))))))....,})))))))))))))}),)))))..))))))...||.((((((((({.....}}}.(((..((((((((((..({,.....((((((((..((((((((.(,.((((((({.(((((....((((((............))))))...)))))...}},...{{{{.((((.((.((((......)))).)).)))))))),))))))..),))))))))...{({...}}}...........))))))))..}}}..}))))))))).)))..))))))).,}.))))))))..)))....))))))......((((((((..((((((({.,{{{{{{{{({{((((.((({{..,,}}))|,||}||.}})).,,..{(({{,,...,}}}}.,})))))}.{(((.,..((((((((.....,{||...,,|,,,,.........,|||{{.,,,))}}....(((((...,,,(((((..(((((((.....))))).))..)))))....((((((((....)}||))))).{{.(((((((.((((((((((....(((((......))))).))))))))))..))))))).},.,......))))}.......))))))))..}.))))....{((((((....))))))}))))))))..)))))))).{{,{((((((..((((((.,,,,....(((((........{(({.,,....,,,..)))).{({.((((((((....,((((((((((((...(,(((..({((((((...{{.....}|.|},.....,,,{....,||||.||{{|{|{||,,{{{..{((((((({..(((((.(((.((((((..((((((((((((((,|,{({{{{,|{{||,.....,|,|,|||||||{{{((.{{||,,.,,||||{||.{((((((..........))))))}...,}...{{|||||||({{.{{,((((({{{{|{|||||.||{||||||...((((...)))).,{{.,.,,..,,,||,,||||.,{{((({(,(.{(({({{(,,..,,}}}}.((((((((.......))))))))......{(({{{.,((((((,,.,,,...,,,||||||,.}}}|||{{|,{((.{((,........})).}))..|{..,.))..)}.),)))}}}..,,,},,|.(((({.((({......)))).})))).....}}}},.}}}}}..}})).,,,))))))).}}.}}.}}}})))}}..........{{{{{|.,,,,,,)).))))))||||...,,...})))..||,,|}}},}})}}}......{{{{{((((,,,((({{{(((((((({{{{...(((...{,{{||,.{{||||||}|||||||||....(((...(((,...{((((((((((((...((((((...,,,,)),},,..............,....((((((.......(((.((((((((,,..(({,,,.....))).....).)))))))).))).......))))))...(((.((((...........)))).))).{(((.((((((({,...,}.))))))))))).)))))}..))))))))))...)))..,,|||||{,....{,.,(((((........,||||...},)))}........{((((((((((.((((((.((((.({......(((((....((.((((.(((((((((..{(((((........)))))}.((((((.,{,{,{(,,,(((.,,...,}),)},...{{((({...}}))}})})),.||...},.)))))).......((((....))))((((((((.((((....((((((..,..........(((.(((((((..{((((({((((((...{.(.(((..((((((((((.((((((((..............(((((((((.....(((((((..{({.{.(({...............})).}..,},...)))))))))))))))).......(((........)))..,,{{,,,{{({,,{(((.,{{.{{{.....})).},))))}},..,.))}).,)))))))).))))))..))))..))).)}....)))))}.|||||},..,,{(((((....))))).},.,{{({((,(,,(,((((,{...|||,|{{........,,.................{,.{(((((.......,}})))}}}},...}}}||,,,((((((.........))))))...,(((.{{,({{,.(((..((......((((....)))).......))..)))...,})).)}.,}},...((((..(.(((.((((({....))))))))),,))))...,.....,..}}}.......((((.((((.((.(((....))).)))))).)))).......,,...}}}}))},}},|||,.,|||,...,,({{{,,....,{((({{.(((((..(((.......)))..)))))})}.},.{{{((((({..((((.({....,,.,.))))..||||...,,,......,.,,..}}}}.,}))))}}.}}.}},,,.}))}}}.||||},...})))},,,,}}}))))))))))))))))...)))).))))))))..))))))))).)))).)).....)))))(((((((((((.......)))))).((.(((((((.........((((((((({.(((({(({,....,}}}}..,,.))))....,)))))))))))))))).))(((.(((((,.......,,...{,........},..,,.((((((...))))))......,..,))))))))......(((((.(((..((((((.........))))))..))).))))).}||||,,((((....))},.,,,,..,}}||||....)))).,,)),)))).))))))))).)))))))|{{(({,..,((((((((..{{....((..((.......))..))...},..)))))))))}}},((((.....{{({....)))}.....)})),,(((((....))))){{{((({,((((((((..(((((.(((((......))))).......)))))..)))))))),||,|{............,,|{{{{|.......,|,.,,||(((((((((((.{..((((,{..,,||,....|||....)))}}......}.)))))))))))..(((({..............}))))...,,..}}}}.|{||{||||||||||,}}},....|}}.,|,}},}|{,.....,.,,,|{|||,,,,,,))}})}},,}}}))}||||{,.||,,,,})).,||||}|,||}}}}}},}}}}}}}||||{,||},,}.}}....,}))))))},,},.))))))))).........}))))..(((((,,|,,,,,...............})}}...))))).))))))))))))))(((.{,.(((((({(..(({,.,{,..{((({,......,((((((..((((({.((.(,{{,((((({{..(((({,,.,}}}}..,}}....})))).)),.,}}})))))}))))}....((..((((..((((((....))))))..)))),})}|,,,,.|||.}},}},{{{||||..|,,..,))},}}})}}}}}},......,,))),,))))))))}}.}}}{(((..(((..((((((.....)))))).)))..))))))}}}}}}}},},},}||,.....,}}}||,,,,,,....,....{,(((((((.((((((...((((..,,,....,,))))...)))))).)))))))}..})))}),)}.)))}},.}))))))}})))).{{{{|||...{{{{{{|{|..,||||{.||||({{,,,,.}}.))))}},,,,,....,||,.||,.,,,,,(((((.(((((...((((.{{.(((((.......})))),}.))))..))))).)))))((((.....))))..{((((((((,..{((((.{{{,..((((((....)))))).((((((.(((((((......,(({,...})),.......))))))),|.....{{{,,..}}}..)))))).....(((((((.......))).))))......((({,.,.{,{{..(((((({...}))))))..}).,....)))).)))).)))})))))))))}|,,||)||||,||{,{.......,,,|,.|||||....}}},,)))))..))),}.))))))),||||||,||},||||,...,}},}}})}}}...))))))))))).))))),,,|(((.....))),(((({....}))))((((,,.,.((((((.(((((.....))).)).))))))...,.))))))))))..))))))))).,......{{{,.,,||.|}....,||||||{|,,{{{(,,((.(((.((((........))))..)))))..}}}|,||,.........,}))))))}}.((((((({....})))))))...,||||{,||||||.{{{{||..{{{....}}}.(({{{{.....,...)))))).)}))}}...},)),}})))}))})))},))))}..}))))))).))))))))).,.)))))).,,,))))).)))))))))|...||||}}}),,}))}...,}))}}}}}.}||||,((((((,,.....(((.(((((........))))).)))||||..}|||||{|,|,,,.((({{{(((({(((((((......{(,,,.||,{{(((((......})))}.{(((((((((((((.....)))))))))...))))|(((,,(((((((({{.(((........}}}...,.}}})),))})}}}}}.........,..,{{|||,(((({(((((((.......((...((({{.(((,,..})),)))))...))..)))))))..})))),,,........,||||||.|||.}}||{{{({.{{........)).})))).)},||}},.,}})))|||{||,....}}}}}||||,||}}}|,|,.{(((((((((({...(((({.,....,,..)))))(((({...{{{{.........}}}}|,|}}}}........(((({{{,.,||}}}}}..|})))))))))},.|||{{|||||||,,|,,.|,,,,,|,,..,},,|||,,,....,}}.,}}},,....||||||||||||{{........{(((((((((((((((((.(((....))).)))))))))))..(((((((((....((((...))))...,)},)})})),)}}..))))))|((.(((((((((((({{.....||.................(((((.....))))))))))))))))).}}|((((((.........,,...,(({((,{{{{.....||||,|||||}|||||||}|}||||}}}},.......,,,,......{((({(((((,,,{{{{||{,({,(({(((.(({(...........,,.....,)})),)))))).,,.}|||,.},,}}},,,,...{((({...,}))))..,,{{((({,,,.,,,,,,|||||{{{{{||....{{{.|||{{,,..{|||||...,{{,.,,{{{||,|||{{(.,,,,,||||||||,||}}}.,|||,.......{((({.((((((.,{{{(((((((..,((((((........))))))))))))),,)}}.,,.)))),)).)))))|,,,,}|,,,|||||,||},,..}||||},.,,|||||||.........,....{(((......)))),{{{{{((((((,.,{{,{(({{{{{{{((((,.((((((((({,(.(((((.{{((((((,.(((((...(((..(((((((...)))))))..))).)))))...))))))......}}))))}....{(((((..(((((((.((..(((((((....))))))).....)})))))}),....))))},.(((({((((((........))))),.......{{{{,((((((((((...(((((((.....,{,......,,,)))))))))))))))))..}}}}}|}|}}|,..,..,,....{{||||||.},|||,..,,)))},,}}))),,}}}..|||||||}}}}}},,},)}}|||,..,}}.}})}}}}||{((,,.(((({,{{((,,,.||||.|}},.....},,}},,))}}}..},))))).,,...{((((((({.{((..................}}}..))))))))}))),|,,,.|||||}},,,{{{{({{{...}}}}.,,)))))....,.|||||||||{||||},...,,{({,,((({({...{{{{.........,,,,)))}...,.}}}}},..,},|,||||{||}}||||{|||||}}|||,.{{,{....,|||,{|||,,,{,{(({{,,{,,.,{{}|{,},{|||||,||{{{.......{||......}))))))).}))))),,,))))}...)))...),....))))))}|}}}||..{,,{{|{,,||.,}|,....|||||||.,|},.....||.|||||,,...,....,......|}}}}}}..,,,((((((((,{.......,,}}..)))))))),..((.(((.((((....)))).))).)),}}.},}}..}}))}}}))))))),..{{{{...,,,|{{|},,},))}))}},,.,,}}}},,..}}},))))))})))),))),,.{{|||{{.{{{{.{{....}).)))),)))))),,,,}}})}}},}||,,||,,||}}})}},,}}}}},.})},}})}|}}}||,,....{||||{{{.||}},}}}},))}|{{{,,,,}))).}}}.},,}}))}}}}}}))),,,..},})},})))}........}}})))),}})))))))))),|||,,,|||...........}}}))))),,,,))))))).))))).........................

Transcripts

ID Sequence Length GC content
GCUUAGUGCUGAGCACAUCCAGUGGGUAAAGUUCCUUAAAAUGCUCUGC… 9032 nt 0.4160
GGGGCGACGUGCCCUGCGUCCCCCUCGGCGGGCUGCCGCCGUGCCCGCG… 2616 nt 0.4247
Summary

This gene encodes coagulation factor VIII , which participates in the intrinsic pathway of blood coagulation ; factor VIII is a co factor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIII c. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that coagulation factor VIII (FVIIIra) is a proteomic marker present on the endothelial cell surface a few minutes after wounding, showing a significant increase in wounds aged 15–30 minutes [Ros et al. DOI:10.3389/fmed.2021.786798]. However, its utility as a specific vitality marker is contested, as one study found it was not useful for vitality differentiation, and another noted interstitial staining in vital stab injuries yielded 100% sensitivity but only 47% specificity due to post-mortem false positivity [Casse et al. DOI:10.1177/0025802415590175].