Basic Information

Symbol
FABP3
RNA class
mRNA
Alias
Fatty Acid Binding Protein 3 H-FABP Mammary-Derived Growth Inhibitor O-FABP FABP11 MDGI Fatty Acid Binding Protein 3, Muscle And Heart Heart-Type Fatty Acid-Binding Protein Fatty Acid-Binding Protein, Heart Muscle Fatty Acid-Binding Protein Fatty Acid Binding Protein 11 M-FABP Fatty Acid Binding Protein 3, Muscle And Heart (Mammary-Derived Growth Inhibitor) Epididymis Secretory Sperm Binding Protein Fatty Acid-Binding Protein 3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_004102.5
Sequence length
1097.0 nt
GC content
0.4968

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-341.30 kcal/mol
Thermodynamic ensemble
Free energy: -360.62 kcal/mol
Frequency: 0.0000
Diversity: 279.27
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((((((..((((...((((.(((..((((((((....((((((...(((.((((....))))..)))...))))))....))))))))..))).)))).......((((((((......))))).))))))))))))))((((((.....))))))((.((((..(((((((................((((((....))))))..................(((((((((......((((.....))))...)))))))))((((((((.(((((.((((((..(.(((((((((......))...(((((.....((((((((...(((((((.(((........)))..)))))))...(((((.(((.((....))))).)).)))...((((...(((((((.((......(((.((((((((((.(((...((....))...))))))......))))))).)))((((((..........(((....)))...........))))))....(((((((((..........((((...)))).....(((.(((...))))))((((((......))))))(((((...)))))(((.(((((((((((.((.....................))))))).))).))).))).))))).))))......((((((((((..(((((........(((((...))))).......))))).))))))))))....)).))))))).))))((((((...........(((((((.(((((((....((((..((....(((((((.......)))))))....))))))...(((((............................)))))..))).)).)).)))))))..)))))).))))))))((((....)))).(((((((((((...(((((...)))))...)))))...))))))))))).(((((((((..................)))))))))...))).)))).)..)))))).)))))))........)))))).(((((........))))).)))))))...)))).))
Thermodynamic Ensemble Prediction
,,,,,.(((((((..((((,{{((((.(((..((((((((....((((((...(((.((((....))))..)))...))))))....))))))))..))).)))).,.....((((((((......))))).)))))))))))))}((((((.....))))))((.((((..(((((((........,,{{{,..{(((((....)))))),,{{{{.....,....,,({{{(((,.......,|||....,)),,..}))})))))){{{|||||,(((((.((((((..(.(((((((((,,....||...({{{|,....((((((((...,{{(({{.((({{{.{,.{|||.,||||||}.|.||,||.}|{||||||||}.....{{{{{...,,||}}}{{{{{{|,|,||||,{(((,((((({{{{{.{{{||,{,..,{||..{||||||.{,..,||,,|||.|||((((((..........(((....)))...........))))))..}}},)))})}}.,)),,,}}}|||,...}}},.....(((.(({...})))))((((((......))))))((((.,....,,,.|,}|||,,|||||,,|||||,................,}}}|}||,|}}.)))}))|,|}}}},,,.....|||((((((((((..(((((.,,.....{((((...))))).......))))).)))))))))}...,}),))))))),}}},((((((....,,.{{{.(({((((.{((((((....{(({{.((....(((((((.......)))))))....)}||}....|||||.....,,,,......,,...........})})},.))).)).)}.)))}))}..)))))).))))))))((((....)))),(((((((((((...(((((...)))))...)))))}..}))))))}}}}.,((((((((..,..........,....))))))))),}.})).)))).)..)))))).))))),,........}}}}}}.(((((.{....,.))))).)))))))...)))).)}

Transcripts

ID Sequence Length GC content
GCCGUCGGAGCCCUUGCACGCCUGCUCUCUUGUAGCUUCUCUCAGCCUA… 1130 nt 0.4965
GCCGUCGGAGCCCUUGCACGCCUGCUCUCUUGUAGCUUCUCUCAGCCUA… 1097 nt 0.4968
Summary

The intracellular fatty acid-binding proteins (FABPs) belongs to a multigene family. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Fatty acid-binding protein 3 gene contains four exons and its function is to arrest growth of mammary epithelial cells. This gene is a candidate tumor suppressor gene for human breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Forensic Context

A study in pigs demonstrated that the FABP3 was commonly regulated in both cold-tolerant Tibetan and cold-sensitive Bama breeds upon short-term cold exposure, indicating its role in lipid metabolism during cold adaptation [Yang et al. DOI:10.3390/ijms24087431]. In mouse cardiac mesenchymal stem cells, overexpression of HDAC11 led to a downregulation trend in the FABP3, suggesting its expression is suppressed during transcriptional reprogramming that promotes cell cycle progression and proliferation [Zhang et al. DOI:10.3390/biom15050662].