| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCGUCGGAGCCCUUGCACGCCUGCUCUCUUGUAGCUUCUCUCAGCCUA… | 1130 nt | 0.4965 | |
| GCCGUCGGAGCCCUUGCACGCCUGCUCUCUUGUAGCUUCUCUCAGCCUA… | 1097 nt | 0.4968 |
The intracellular fatty acid-binding proteins (FABPs) belongs to a multigene family. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Fatty acid-binding protein 3 gene contains four exons and its function is to arrest growth of mammary epithelial cells. This gene is a candidate tumor suppressor gene for human breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
A study in pigs demonstrated that the FABP3 was commonly regulated in both cold-tolerant Tibetan and cold-sensitive Bama breeds upon short-term cold exposure, indicating its role in lipid metabolism during cold adaptation [Yang et al. DOI:10.3390/ijms24087431]. In mouse cardiac mesenchymal stem cells, overexpression of HDAC11 led to a downregulation trend in the FABP3, suggesting its expression is suppressed during transcriptional reprogramming that promotes cell cycle progression and proliferation [Zhang et al. DOI:10.3390/biom15050662].