Basic Information

Symbol
FABP4
RNA class
mRNA
Alias
Fatty Acid Binding Protein 4 A-FABP AP2 Adipocyte-Type Fatty Acid-Binding Protein Fatty Acid-Binding Protein, Adipocyte Adipocyte Fatty Acid Binding Protein Adipocyte Lipid-Binding Protein AFABP ALBP Fatty Acid Binding Protein 4, Adipocyte Epididymis Secretory Protein Li 104 Fatty Acid-Binding Protein 4 HEL-S-104
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_001442.3
Sequence length
911.0 nt
GC content
0.3743

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-233.10 kcal/mol
Thermodynamic ensemble
Free energy: -250.46 kcal/mol
Frequency: 0.0000
Diversity: 213.22
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.................((((((.....((((.......))))......((((.((((((((((.....))))).).)))).))))...(((((........))))).....((.(((((((((((..........((((....((((.((((((((......))).))))).))))...))))..))))))))))).)).(((((.(((...))).))))).....(((((.((((((........((((((((((((((((.......(((..((((....))))..)))(((((((((((((.((((.((((((.((((..((((.((((((.....((((.....(((..((((...(((((((....(((((((...........(....)..........)))))))((((((((((......)))).)).))))...((((((((.....((((...(((((.((........))))).))...))))....))))))))((((((.(((...(((((...)))))....)))...))))))))))))).)))).)))....)))).....))))))..))))..))))...((((.(((((((((.((...((((((......)).))))..)).))))))))).)))).......)))))).))))...))))).)))))..))).)))))))))))((((((((((...(((((((((..(((((((((((...........)))))).....)).)))...)))))))))....))))))))))..(((((((((((...((((........))))...))))...)))).....)))(((.((((......)))).)))..)))))......)))))).)))))..)))))).......
Thermodynamic Ensemble Prediction
.,,,.......|||...((((({.....((((.......))))......((((.(((({(((((.....))))).}.)))).))))..,(((((........))))).,...((.{((((((((((.........,((((....((((.((((((((......))).))))).))))...)))).,))))))))))).)).{{(((,|{|...,}}.)))}}.....(((((.((((((........((((((((((((((((.{{{.{{((({,,{{(({{..,}||.{{{{,.{{{,|||||..||||,,.(((((....(({.....})|}))}}}))}||.}},,||{|,..,({({(((((({,...,{(((((........,..{....}..,.......)))))||(((({(((((......)))),}}.))))}}.((((((((,,...((((...((((,,((........))))).))...)))).,..)))))))){(((((.(((...(((({...}))))....)))...))))))}}})))}.,,||,|,,....,))},.,,,)))))}..,||{......}}}{{((,({(((((({.{{...,,,((({{{{..,,.,,,)}}))})}))})))).)))),.}}|}|}}}}||{||||...,}}||,)}))},}}}}})))))))))},(((((((({....(((((((((..{((((((((((,,......,,,)))))).....)),,))...)))))))))....,}))))))))..(({((((((((...((((........))))...}}))...)))).}},,)))(((.((((......)))).))),})))))......)))))).)))))..)))))).......

Transcripts

ID Sequence Length GC content
ACAGCACCCUCCUGAAAACUGCAGCUUCCUUCUCACCUUGAAGAAUAAU… 911 nt 0.3743
Summary

FABP4 encodes the fatty acid binding protein found in adipocytes. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice, rats, monkeys, and human cell lines demonstrated that ionizing radiation significantly alters cutaneous fatty acid metabolism, increasing the expression of the FABP4 in all skin cell subpopulations [Tu et al. DOI:10.1016/j.jdermsci.2023.01.001]. In human skin wound healing, single-cell analysis identified the FABP4 as a marker expressed in immune cell clusters within the wound-edge spatial transcriptomics data [Liu et al. DOI:10.1016/j.stem.2024.11.013].