| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGCACCCUCCUGAAAACUGCAGCUUCCUUCUCACCUUGAAGAAUAAU… | 911 nt | 0.3743 |
FABP4 encodes the fatty acid binding protein found in adipocytes. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Jul 2008]
A study in mice, rats, monkeys, and human cell lines demonstrated that ionizing radiation significantly alters cutaneous fatty acid metabolism, increasing the expression of the FABP4 in all skin cell subpopulations [Tu et al. DOI:10.1016/j.jdermsci.2023.01.001]. In human skin wound healing, single-cell analysis identified the FABP4 as a marker expressed in immune cell clusters within the wound-edge spatial transcriptomics data [Liu et al. DOI:10.1016/j.stem.2024.11.013].