Basic Information

Symbol
FABP5
RNA class
mRNA
Alias
Fatty Acid Binding Protein 5 PA-FABP E-FABP KFABP Psoriasis-Associated Fatty Acid-Binding Protein Homolog Fatty Acid Binding Protein 5 (Psoriasis-Associated) Epidermal-Type Fatty Acid-Binding Protein Fatty Acid-Binding Protein 5 Fatty Acid-Binding Protein, Epidermal PAFABP EFABP
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Mechanical injury analysis Other applications

MANE select

Transcript ID
NM_001444.3
Sequence length
676.0 nt
GC content
0.4231

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-175.80 kcal/mol
Thermodynamic ensemble
Free energy: -189.14 kcal/mol
Frequency: 0.0000
Diversity: 145.63
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((....((((((((((((((......)))))..((...(((((((((..((((((.((((((..(((((...)))))..)....)))).).))))))...))...((((((.(((....))).)..))))).)).)))))....)).(((((.........)))))((((...)))).....((((((((....)))))))).....((((..........)))).(((((((((((....((.(.(((((((.((...)).))))))).).))......((((..((((((.(.(((........((((((((........)))))))).......))).)))))))..)))).((((.(((((.((((((.(((...(((((..((((((.(((((((.((((.(((((.(((.(((.....))).)))(((....))).(((((......))))).....((((((.(((......)))...))))))..................(((((......)))))....))))))))))))))))))))))..))))).))).))))))......))))).))))....................))))))))))))))))((((((((((......)))..))))))).......))))..))))))..
Thermodynamic Ensemble Prediction
..((((((..{,(((,((((((((((......)))))..{({{,({(((((((..((((((.((((((..((({{...)))}}..,....)))).).))))))...}}...|||(((.(((....))).)})),})}.)).)))}|..|,|||,|{{{.....,|||)},,.||||,..}}},..,|.((((((({....}))))))).....((({..........}))}.(((((((((({....{{.{,{((((((.{,...}).))))))).},}}......((((..((((({,(.(((........((((((((........)))))))).......))).)))))))..)))){(((({({{{,.((((((.(((...(((((..((((((.{(((((,{(((,{(((((.(((.(((.....))).)))(((....))).(((((......))))).....((((((.(((......)))...))))))..................(((((......)))))....)))))))))))))))}))))))..))))).))).))))))...,}.))))},)),,...|||,,,...,}..,.,.))))))))))))))))(((((({(((......)}}.}))))))).......,)))}.))))))..

Transcripts

ID Sequence Length GC content
ACAGCACGCUGCCACGCCGACGCAGACCCCUCUCUGCACGCCAGCCCGC… 676 nt 0.4231
Summary

This gene encodes the fatty acid binding protein found in epidermal cells, and was first identified as being upregulated in psoriasis tissue. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABPs may play roles in fatty acid uptake, transport, and metabolism. Polymorphisms in this gene are associated with type 2 diabetes. The human genome contains many pseudogenes similar to this locus.[provided by RefSeq, Feb 2011]

Forensic Context

A study in mice demonstrated that the FABP5 is upregulated in the typical monocytes of patients with heart failure and might induce a proinflammatory monocyte phenotype [Li et al. DOI:10.3389/fcvm.2022.768834]. In a separate investigation, mouse liver exposed to α-particle radiation showed that the FABP5 was over-expressed following Kupffer and endothelial cell-specific exposures but was under-expressed after γ-ray exposure [Roudkenar et al. DOI:10.1269/jrr.07078]. A review of traumatic brain injury (TBI) in humans, rats, and mice indicates that the FABP5 is a protein biomarker of brain damage that can be identified in serum and cerebrospinal fluid to evaluate injury severity and correlate with morbidity and mortality [Mangiola et al. DOI:10.1155/2015/736104].