| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGCACGCUGCCACGCCGACGCAGACCCCUCUCUGCACGCCAGCCCGC… | 676 nt | 0.4231 |
This gene encodes the fatty acid binding protein found in epidermal cells, and was first identified as being upregulated in psoriasis tissue. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABPs may play roles in fatty acid uptake, transport, and metabolism. Polymorphisms in this gene are associated with type 2 diabetes. The human genome contains many pseudogenes similar to this locus.[provided by RefSeq, Feb 2011]
A study in mice demonstrated that the FABP5 is upregulated in the typical monocytes of patients with heart failure and might induce a proinflammatory monocyte phenotype [Li et al. DOI:10.3389/fcvm.2022.768834]. In a separate investigation, mouse liver exposed to α-particle radiation showed that the FABP5 was over-expressed following Kupffer and endothelial cell-specific exposures but was under-expressed after γ-ray exposure [Roudkenar et al. DOI:10.1269/jrr.07078]. A review of traumatic brain injury (TBI) in humans, rats, and mice indicates that the FABP5 is a protein biomarker of brain damage that can be identified in serum and cerebrospinal fluid to evaluate injury severity and correlate with morbidity and mortality [Mangiola et al. DOI:10.1155/2015/736104].