Basic Information

Symbol
FADS1
RNA class
mRNA
Alias
Fatty Acid Desaturase 1 FADSD5 D5D Acyl-CoA (8-3)-Desaturase FADS6 TU12 Delta(5) Desaturase Delta-5 Desaturase LLCDL1 Linoleoyl-CoA Desaturase (Delta-6-Desaturase)-Like 1 Delta(5) Fatty Acid Desaturase Delta-5 Fatty Acid Desaturase EC 1.14.19.44 EC 1.14.19
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_013402.7
Sequence length
4364.0 nt
GC content
0.4934

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1476.80 kcal/mol
Thermodynamic ensemble
Free energy: -1553.84 kcal/mol
Frequency: 0.0000
Diversity: 876.74
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.((....)).))))))..(((((.(((((((((((((...(((((((.((((((..((.((((((......((..((((.((((((..(((((((((.(((((.((((.(((((......)))))))))))))))))))...)))).))).((((...........))))))).))))..)))))))).((((((.(.((((....))))..).))))))(((.((((...(((((....)))))..)))))))..((((((.......))))))..(((......)))(((((...((((((......))))))...)))))))..)))))).))))))).(((..((((...(((((..(((((...))))).))).))))))..)))((...))((((((((((.(((((....(((((((((((.(((((((.((((((((....))))))))..)))...(((.((((...)))))))...(((...((((.((((((((((.((((((....))))))..(((((.(((((((.................)))))))....((((((((((...(((.((........)).)))...))))))))))((((((.......)))))).....))))).((.(((((((((((.......)))).)))))))..))......(((((((((...((..(.(((((((((((((((.((((((((..(((((((...((((((((((..(((..(((((((.((..((((.(((((((((((...(((........)))...)))))))).....)))))))((((......))))...((((.(((...))))))))).)))))))))).))))....))))))..))))))).........((((((((((..(((.....((((((.......((((((((((((((((((((((((...((((((((..((((((((.((((((...((((((........(((.((......))..))).......))))))....((.((((((((((...)))).............((((((((((......(((((((....)))))))((((.((((((((.(((...((.......))..))).)))))))))))).......))))))))))...)))))).)).((.((((.((((((...((....))..))).))).)))).))...((((((((.((.......)).))))))))..)))))).)).(((((..((((...((....((((((((((....)))))).))))..)).))))))))))))))).((((((..(((.....)))....))))))..(((..(((((((((((((...((((..........)))).)))................((.((((...(((((((......(.(((((((....))))))).))))))))....)))).))..((((.((....)).))))......((((.......))))..((((((...(((((((((....))))..............)))))..))))))))))))))))..))))))))....)))....)))))))))))))))(((..((((......)).))..)))..........((((((..((((((.((((........)))).))))))..))))))..............(((((((((((....(((....((((((.(.........).))))))...)))..))))))))...))))))))))))..................))))))....)))))))))))))...)))))).))....)))))))....)))))))).)..))....).))))))))))))).)))))))))..))).............)))).))))))))))).....((((....(((((((........))))).))))))(((...((((((((.((((((((((((..(((((((.((((....)).)))))))))))))).)))....(((((((.((((..((.........................(((((.......)))))...(((.((((((........)))))))))...((((((((((((((..((((..((((((((((.((((((...(((..((...((((((.....((((............))))...))))))....)))))..)))))..((((.(((((((.......))).)))).)))).(((.((((((.(((((((((...(((.((((((((......))))).....))).)))))))).)))).))))))..)))(((((.((((((((((((......)))))))))))).))))).......).)))).))))))..)))).....(((((.((((((((........(((((.......)))))(((((((((...............)))))))))...........)))))))).)))))...........((.((((.((((.........)))))))).))(((((......)))))....)))))))))..)))))((((((((.((((((((((........(((((((((.(((....))))))))))))..((((((......(((((..(((................))).))))).......))))))(((........)))..))))))))))...)))))..)))..............(((((((((((((((..(((((((((.........)))))))))((((((((((..(((((..(((.(((((....)))))..)))...)))))...))))))))))............((((((....)))))).))))))))..))))))).))..)))).)))))))..)))).)))))))).)))..((((((((((..((.....)).))))))))))........((((((((((........(((......))).(((((.((((....))))...))))).......((((.((...((((....))))))))))))))))))))))))).))))))))))((((((.......))))))....))))..))))))((((......(((((((((((((((((((........)))))..(((((((((...(((((((((((...........(((((((....((((...........(((((((((((((((...........)))))...))))))...))))..........))))....)))))))..(((((((......)))))))))))).))))))........))))))))).((((........))))))))))..))))))))((((........)))))))).)))..)))))(((........))).(((((((((((..((((.(((((......((((((((((((((((((...............((((((((.(((((.........))))).))))))))..(((((((((..((((((.((((......(((((...(((((((((((((((((.((((((...((((((.....))))))....)))))).)))((((...(.(((((.(.((((...)))).).).).))).)))))...)))))))).))))))..(((((...........))))).................(((((...((((.(((((....(((((((((.......((((..((.(((.(((((..((((((........................).))))))))))))).)).))))..((((((((((((......))).((((((.....))))))(((((.........(((((.(((((....)))))..(((...))).(((.......)))((((.((((((.((((.(((((....((.(((((((((((...((....))))))))).)))).)).....))))).)))).)))))).))))....((((....))))....))))).)))))...)))))))))..(((.((((..((((((..(((((.....))))).)))))).....))))..))).......)))))))))...))))).))))....))))).......)))))......)))).))..))))...))))))))).)))))).........))))))))))))(((..(((...)))..)))...........))))).))))....))))))))..)))...
Thermodynamic Ensemble Prediction
((((((.((....)).))))))..,((((.(((((((((((((...,((((((.((((((..((((((,((({...(((..((((,(({(((.,(((((((((.({({((((({,(((((......)))))))))))))))))))...)))).)})}|,,||...{{{,...,})))}}.}))),.}})|}}}}.{({{|{.,.{{{{....||||{||.||||}}{{{}||||}}.|||||,,..}||||.{||,}}))},||||({|{....,))))),,.(((......))}{{({{...{{{{{{,,,...)))))),,.)))})))..)))))).))))))}{(((..((((...(((((..(((((...))))).))).))))))..)))|,....,((((((((((.(((((,...(((((((((((.(((((((.((((((((....))))))))..)))...{(.{((((...))))))}.,.{{{...{(((.((((((((((,((((((....))))))|{((((,.(((((((.................)))))))....((((((((((...(((.((,.......}).)))...)))))))))}((((((.......))))))...},)))||.{{.(((((((((({.....,.)))}}}))))))..))}}}...(((((((((..,((,.(.((((((((((((((((((((((((,,(((((((...((((((((,{.,((({{(((((((,({..((||,{{|{{{{||||,..|{|..,,,...)})..,)}}}}}||,,...}})))))|,{(,,,,..,))),,.((((.(({...))))))),|{|||}}},)))}),,}....))))))..)))))))..,{,,.,{((((((((((..(((..,..((((((........{,,((((((((((((((((((((,,.{{{{{{{{,.{((((,((.((((({...((((((........(((.({......}}..))).......))))))....((.((((((((((...)))).............((((((((((......{((((({....))))))){((({(((,(((,.,((,..(({,,....,,..}}},)))))))}))})}.}}}},))))))))))...)))))).)}.((.((((.((((((...((....))..)))}})).)))).))...((((((((.((.....}.)).))))))))..)))))).)),(((((..((((...((....((((((((((....)))))).))))..)).))))))))))}))}},((({{(,.,,...,,,}||,,,,}})))).{(((..(((((((((((((...((((..........)))).))),...............,{,((((...(((((((......{.(((((((....))))))).))))))))....)))).,|{.((((.((....)).)))).}....{{({......}))))..((((((...((((({({(,...}}}}..............)))))..)))))),)))))))))..))))}))}.,,.)))....))))))))))))))},,,.,}}))},.,|}|{.{|..{||,....,}}..||||||}}||||||,|{(({.,,,..{||||{{,||||{.{{{|{(((((({,,((({{{((,,,.}}}..,,,,(((,...,})),,}}||,|..,,,,)}}}}))))))))}})))).,.))))),))))))),,,..,}}}.))}},...,,.)))))),.,.))),))))))))).}.)))))).)}....))))))),...}))))))).)..)),,..),}))))))))))))}})))))))}..}}}.............)))).))))))))))).....((((,...({(((((.{....}.))))).)))))){{{...((((((((.((((((((((((..(((((((.((((....)).)))))))))))))},)))..,.(((((((.((((..((.........................{{,,.......{|||{{{..,||}||||{{..,,,,,,|,}||||||,,.((((((((((((((..((((..((((((((((.((((((...(((,,,,...((((((.{{..((((........,,..))))}}.))))))...,)})))..))))}..((((.(((((((.......))).)))).)))).({{.((((((.(((((((((...(((,((((((((......))))).,...))).})))))))))))).))))))..}))(((((.((((((((((((,....,)))))))))))).)))))......,).)))),})))))..)))).{{{{(((((.((((((((....,,,,(((((.......))))){{|{(({{{...,,,,........))))}}}}}...........)))))))).))}},..}}}}}}}.,((.((((.{(((,........)))))))).))|((({......))))}....)))))))))..)))))}|..,{,,.((((((((((........(((((((((.(((....))))))))))))..((((((......(((((..({(,,,,.........,}}))).))))).......)))))){{{........}}}..))))))))))...}}}},.,}}},,..,}},,,....(((((((((((((({..(((((((((.........))))))))){(((((((((..(((((.,(((.(((((....)))))..))).,.)))))...)))))))))}............((((((....)))))).})))))))..))))))).))..)))).))))))),.)))).)))))))).}}}..((((((((((..((.....)).))))))))))........{(((((((((.,{,....||||....,||,.{((((.(({{....}}}}...)))))....,,,((((.((...((((....))))))))))))))))))))))))).))))))))))((((((.......))))))....))))..)))))){(({......{((((((((((((((((((........)))))..((((((((({..(((((((((((,........{.(((((((....((((...........(((((((((((((((...........)))))...))))))...))))...,..,...))))....))))))).}{((((((......)))))))))))).))))))..,.....))))))))).((((........))))})))))..}))))))}((((........))))}))}.)))..))))|(((........)))}((({(((((((..((((.(((((.,,.{.((((((((((((((((((...............((((((((.(((((.........))))).))))))))..(((((((((.,((((((.((((......{({{{{,.(((((((((((((((((.((((((...((((((.....))))))....)))))).)))((((...(.((({(.(.((((...)))).).}.).))).}))))...)))))))).)))))).}|((((,,.........}}})}},...............,{,((...((((.(((((.,..(((((((((.......((((..((.(((.(((((..{(((({.{{................,....),})))))))))))).)).)))).,((((((({{.{(,.....|||||{|{{|,,,,,)))))},{{{{|||......(((((.(((((....)))))..(((...))).{{,.......}},((((.((((((.((((.(((((...,((.(((((((((((...((....))))))))).)))).)).,...))))).)))).)))))).))))....((((....))))....))))).........}}))))))),,|||.||{,..((((((..(((((.....))))).)))))).,,,.,,,,..,)).......))))))))).,.))))).))))....)))))..,.,..)))))......)))).)),.,)))...))))))))).)))))}.........)))))))))))),|,..,,,..,||...|}}.......}},.))))).})))....))))))))..))}...

Transcripts

ID Sequence Length GC content
GGCAGCCCAGCUGUGAGUUGCCCAAGACCCACCGGGGGACGGGAUCUCG… 4364 nt 0.4934
Summary

The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the FADS1 exhibited a mid-mission, flight-specific increase in expression in peripheral blood mononuclear cells during a one-year spaceflight, with most cell fractions showing relatively similar expression profiles over time [Schmidt et al. DOI:10.1159/000506769]. In a separate human study of monozygotic twins, the FADS1 was found to be downregulated with greater body mass index specifically in female twin pairs, indicating a sex-specific transcriptional response to obesity in adipose tissue [Haltia et al. DOI:10.1002/oby.70078]. Another human study found that the FADS1 was up-regulated in abdominal subcutaneous adipose tissue in response to a 7-day overfeeding intervention [Shea et al. DOI:10.3945/ajcn.2008.25970].