Basic Information

Symbol
FASLG
RNA class
mRNA
Alias
Fas Ligand FasL APT1LG1 TNFSF6 CD178 Tumor Necrosis Factor Ligand Superfamily Member 6 Fas Ligand (TNF Superfamily, Member 6) Apoptosis Antigen Ligand Fas Antigen Ligand CD95 Ligand CD95-L CD95L APTL Tumor Necrosis Factor (Ligand) Superfamily, Member 6 Mutant Tumor Necrosis Factor Family Member 6 Apoptosis (APO-1) Antigen Ligand 1 Tumor Necrosis Factor Ligand 1A CD178 Antigen ALPS1B TNLG1A FASL
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Mechanical injury analysis

MANE select

Transcript ID
NM_000639.3
Sequence length
1805.0 nt
GC content
0.4693

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-570.70 kcal/mol
Thermodynamic ensemble
Free energy: -602.62 kcal/mol
Frequency: 0.0000
Diversity: 495.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((.(((..(((((......)))))....((((((((....))).)))))....((((((....))))))((((((((((((.((..((((((((......)))))..................(((((.....))))))))..))))).))))))))).(((((......)))))(((((((((.(.((.((...(((((.((.((((.....)))).))..))))).(((((((((((((((((((((((((.((((....(((.((.(((.((.(((((...(((...(((((((.((((.((.(((((((...(((((..((((((....).)))))..)))))......))))))).))...)))).))...)))))....)))((((((((((((..((.((((((((...(((((((.(((((.(((.(((...)))))).)))))..(((((.....)))))......(((.((....(((((((((((((((((...............))).))).))...))))(((((((...(((((.(.((.......)).)..)))))...)))))))......)))))....)).)))..)))))))..))).............(((((((((((.(((.(((..(((((.(((((((((.......)))))))))..)))))..))).....(((......)))...)))..))))))).))))..))))).))..)).))))))))))...))))).)).))).)))))(((((((.(((.........(((((..((((.(((((((.(((.......))).)))).....)))))))..)))))))).))))))).((((....))))((((((.((.(((...........)))))..))))))..(((((((((((.....((((.......((((.((((((..(((((((((((..(((((((.(((((((.((........(((((((((.......((((((((((.(((.......).)).)))))))))).((((((..((((.........))))..))))))...((((((..((((...(((.........)))...)))))))))).......)))))))))(((.((...(((((((((((((((((((((............))))).....)))))..))))).))))))...)).)))...(((((((......)))))))((...((((((...))))))...)).(((((..((((((......))))))..)))))..(((.....))).....)).)))))))..))))))).....)))))))..))))..))))))))))........))))....)))))))))))(((....))).((((((.((((((((....(((...(((.((((((((....))))...........)))).)))))))))))))).((((((.........))))))(((((...)))))....)))))).....)))).)))).))).))).))).))).))).))).)))..........)).))...).))).)))))).....((((((.....))))))((..((((((((........))))))))..))((((((((((......................)))))))))))))))).....(((..(((((..(((((.......(((((.((.((((.((((((...))))))...)))).)))))))...)))))..))))).))).....
Thermodynamic Ensemble Prediction
...((((({{..({{((,....{{||||||..((((((((....))).)))))....((((({....})))))((((((((((((.((..((((((((......)))))..................(((((.....))))))))..))))).))))))))).,|{(((((..((..(((((((..................))))))).,)}.)))))})}},.,)))))}|{{((((((((((((((((((((((.(({({.((((({,({,(({((.{,,,,..,(({,,.(((((((.((((.((.(((((((.{.(((((..((((((....),}))))..)))))....,.))))))).))...)))).))...)))))....))}(((((((((((({.,({((((((((,,.,,{{|||.(((((.((,{(((...)))))).)))))..(((((.....)))))....,||}}}.,,}|{{{.((((((((((((((...............)),,))).))...)))))).}}}}..(((((((.(((,.....{{{(,,,,,||}..}).|||||......))),)))).))).))))}))))})..}}}........,,}}}{{(((((((((.(((.{((..(((((.(((((((((.......)))))))))..)))))..))}.....(((......)))...)))..)))))))}),}}..|||},.)},.}},))))))))))...})))).)).)))}))}),(((((((.(((..,,,....(((((..(({(,,,,((((.(((.......))).)))).....})}))))..)))))))).))))))},{{{{....||}}|(((((.{{{(((.,,........}}}},,.)))))|||(((((((((((.....{{((....,,,((((.((((((..(((((((((((..{{{((((.((((((({(({{..{{,{(,,,|||||.....,,((((((((((.((,,,.....),)).)))))))))).((((((..((((.,.....,.))))..))))))...||||||,,||((,{,({{,,,,...,,||,..,|||}}|||||...{{{{,,,||||,|,...|..}}||,,,||||{(((((((((((............))))).....))))),.}}|||{|||||,...||{||,...{((((((,....,)))))))}},,}|,,|||}}}))),,,...{{.(((((..((((((......))))))..)))))}}.}|}}},}}),,,)}})}.,,))))}.}))))),,.....))))))}..))))..))))))))))........))))..,.|}|}|}}}}|}{((...,|||.,,||||}|||{{|||..,,{{{...(((.((((((((....))))...........)))).))))))))))))),,((((((.........))))))|,||,{{{,,|||,,..,,))))},..,))}),)))).))).))).))).))).))).))),))),.})))}......,,.((((({(({{(,,,..,{|,,{,.((((((((((({((..((((((((........))))))))..))|(((((((((......................)))))))))}..........)))))))))))..,|||,,..,}}}}))))))..||{|||,{{(((((...{({...,|||,,,}}}}}}}})))))})}....,.,......

Transcripts

ID Sequence Length GC content
AGCAGUCAGCAACAGGGUCCCGUCCUUGACACCUCAGCCUCUACAGGAC… 1805 nt 0.4693
AGCAGUCAGCAACAGGGUCCCGUCCUUGACACCUCAGCCUCUACAGGAC… 1759 nt 0.4696
Summary

This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS . The FAS / FAS LG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]

Forensic Context

A study in humans and mice demonstrated that the FASLG is a diagnostic and prognostic hub gene for sepsis, found to be downregulated in human blood datasets and exhibiting varied expression across mouse organs in a cecal ligation and puncture model, being downregulated in serum but upregulated in lung tissue [Sun et al. DOI:10.3389/fgene.2024.1389630]. A study in rats demonstrated that the pro-apoptotic gene Fas ligand (FasL) is a direct target of the FASLG in the context of contusion spinal cord injury, where in vivo inhibition of the FASLG by antagomir-21 significantly increased FasL protein expression at day 3 post-injury, correlating with increased apoptotic cell death, larger lesion size, and worse functional recovery [Hu et al. DOI:10.1089/neu.2012.2748].