| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCAGUCAGCAACAGGGUCCCGUCCUUGACACCUCAGCCUCUACAGGAC… | 1805 nt | 0.4693 | |
| AGCAGUCAGCAACAGGGUCCCGUCCUUGACACCUCAGCCUCUACAGGAC… | 1759 nt | 0.4696 |
This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS . The FAS / FAS LG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]
A study in humans and mice demonstrated that the FASLG is a diagnostic and prognostic hub gene for sepsis, found to be downregulated in human blood datasets and exhibiting varied expression across mouse organs in a cecal ligation and puncture model, being downregulated in serum but upregulated in lung tissue [Sun et al. DOI:10.3389/fgene.2024.1389630]. A study in rats demonstrated that the pro-apoptotic gene Fas ligand (FasL) is a direct target of the FASLG in the context of contusion spinal cord injury, where in vivo inhibition of the FASLG by antagomir-21 significantly increased FasL protein expression at day 3 post-injury, correlating with increased apoptotic cell death, larger lesion size, and worse functional recovery [Hu et al. DOI:10.1089/neu.2012.2748].