Basic Information

Symbol
FASN
RNA class
mRNA
Alias
Fatty Acid Synthase FAS SDR27X1 Short Chain Dehydrogenase/Reductase Family 27X, Member 1 3-Hydroxyacyl-[Acyl-Carrier-Protein] Dehydratase [Acyl-Carrier-Protein] S-Malonyltransferase [Acyl-Carrier-Protein] S-Acetyltransferase 3-Oxoacyl-[Acyl-Carrier-Protein] Reductase 3-Oxoacyl-[Acyl-Carrier-Protein] Synthase Enoyl-[Acyl-Carrier-Protein] Reductase Acyl-[Acyl-Carrier-Protein] Hydrolase Type I Fatty Acid Synthase EC 2.3.1.85 EC 6.3.3.1 EC 2.3.1 OA-519
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_004104.5
Sequence length
8464.0 nt
GC content
0.6528

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3952.50 kcal/mol
Thermodynamic ensemble
Free energy: -4081.87 kcal/mol
Frequency: 0.0000
Diversity: 2114.01
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((....((.((((((((((.(((((((((.((((.((((((((...((((((.(((((.((((((((.(((((((.((((((((((..(((((((((((((((((((((.((.((((((((((((((.(((((((.....((((((((.(((((((..(((((.(((..(((((((....)))))))..)))..((((.(((((....(((((((((((((....).)))))))((((((..((((((.(.....).)))))))))))))))))....))))).(((...((((.((((.(((((((((.((....))((((((.....(..(((...((.....(((..(((((.((....)).)))))..))).....))..)))..)))))))))))))))))))).))))....))))))).........((((((..(((((((.(((.(((((((((.(.((((((((.((((((((((((....((((..(((((.(((((((....((((.(((((.(((((((((((((.((((....))))..((((((...........)))))).((((.......)))).......((((((((...(((....)))...((((.(((.((((((.(((.(((..(((((.((((((((((((.((......)).))))......((((((((..........(((...(((((((((((.(((((((....))))))).)))))))...))))))).........))))))))...))))))))))))).))).))).)))))).))).)))).......((.((((((.....((.((((.((((((....(((((((.((((.............))))))).))))....)))))))))).)).....)))))).)).)))))))).)))).)))))))))...))))).))))..))))))).)))))..))))........((.(((((((((((((((.((..((.((....))))..)).)).....(((.((....))))))))))).....(((((.(((((((........)))))))...((((.((...(((((..(((((((((.((.((((((.((((((((((.....))).))))))).)))))).))...))))))))).)))))...)).))))........(((((((((......))).)..)))))((((((((..(((((.(((......)))))))))))))))))))))...))))))).))......)))))).)))))).))))...(((.....)))...)))).)...)).).))))))....))).)))))))...))))))((((((.((((((((.((((.((((.((......))))).).)))))))))......))).))))))..((((((...))).))).)))))))))))).)))))))).........((((......))))))))))).....)))))))))))..))).)).)))).)))..))).)))))).....)))))(((.(((((.((....)).))))).))).((((((((((......)))))))).))..)))))).))))))))))))))).....(((((((.((.((((((....(((((.(((.((......))))).)).)))(((((..(((..(((((((((.((((....)))).........((((((..((((((((.(((.((((....(((((((((((((.(((.....))).)))).)))))))))...((.((((......)))).)).((((..((((.((.(((((.((.(((((((.((((((((.(((((...))).)))))))))).))))))).)).)))))....)).))))..))))...)))).)))))))))))..))...))))(((((((((.((((((..((((((.(((((.((((((.(((((((.....))))).)).))))))((.((((((.((((((.(((((((((.((((.(((.((((.....(((.((...)).))))))).))).)))).)))))...((((((((((..((...(((((((((((.((((((.(((...)))(((((((.(((...........)))))))))))))))).))...(((.....)))((.((.((((((.(((((((((.((((.((.((((...((((((((((((..((((.(((((((((....(((.((((((..(((((.(((((((..(((.((((.((............)).)))))))...))))).)).)))))..))..)))).)))..(((((((((((.((.(((((........))))))).))...)))).)))))((.(((((.(.(((((((...(((((((((..((((((((.....))))).(((((((..((((.....))))..))))))).))).)))).)))))))))))).)...)))))))((((.((((....((((((((..(((((.((((((((((((((........).)))))))..........((((((.....)))))).....(((((((((((((..((((.(.((((...((((((.((....))...)))))).((((((((((((..((.((.((((..((((((......(((....)))......))))))((((...........))))(((((.........((((((((((.((((....(((((((...((((((((((((.....))))))..)))))).(((..((((((((((.((...(((((((((....((.((((((.......(((((((....)))).)))..(((..((((......)))).)))(((((((.(((((((.((((.((((((((..(((..(((((...((.(.(((..(((...((.((((((.((.((((....)))).)).))..))))..))...)))...))))))...))).)).)))..)))..))))))).(((((.((((.....(.(((((((....))))))).))))).)))))......)).)))))))...))))))).))))))..((((((.((((..(((.((((((..........(((.(((((((.(((((((.(........).)))))))...))))))).)))..))))))........)))..)))).))))))))...))))))....)))...))))))))))))..)))...)))))))))))....))))..)))))).))))))))).))))..)))))))))))).....(((((((((((.(....).)))))))...)))).((.((((((((((((((.((((((((((.(((.(((((.(((((((((.(((((...))))).((((((....)).))))(((((((.((((..((((((((((((.....))).))((((....))))..(((((((.((((((...((((.....(((((((((((..((((.............)))).....((((((((..(((.(((((((((.((((((.(((((((((.......(((((.((((((((((((((.((((((((((...(((....))).))))))))))(((((((...(((((.(((((((((((...((((.(((((....)))))..)))))))))).((..((((.(((((.((.(((....))).))...))))).))))..))(((((.(((......((..(((((((((((((..((..((((((((((((((((......((((.(((((...................(((((((((((..(((...(((((.(((...(((.......)))..))).)))))....)))..)))))))))))..((.(((((((((((((...((((.....((((...)))).))))..))))))))))))).))....))))).))))..(((.((((.((((((((...)))...))))).))))...)))..))).)))))).(((((........)))))....(((....))).....(((((((((((....))))))))).)).)))))))..)).))))))))))..))).))....)))..)))))))))).)))))(((((.(.((((((....)))))).).))))).))))))).((((((((.((((.....))))...(((..((((.......))))..)))))))))))..))))).)))))(((((........)))))..)))).)))))...((((((.(((((((.((..((.((...)).))..)).))))))).))))))....(((((.(((((((..........((((((((((((((..((((((((((.........))))..))))))(((((...)))))...((.(.((((((((..........))))))))).)))))).))).))))))).(((((((((((..(..((((((......))))))((((((.(........).)))).)).)..))))))))))).))))))).)))))))))))))))))).)).......(((((.((..(((((....)))...))..))..))))))))))))))..)))..)))))))))))))))).))).....))))))).))))))))))...((((((((((.(((((..(((.(((......................))).).))....)))))(((((((((.(((((((...((.(((((((...)))..))).).))...))))))).))))))...)))...(((((...))))))))))).)))))))))))....)))).))))))).)).))))..))).)))))))))))))))))).(((..((((((((((..(((.((........))))))))))))))))))....(((((...((((((((.((((.(((...........))).))))))))))))..)))))..((((((((((.((...........(((...((((((.((...)).))))))...)))...((((.......)))).)).)))))))).)).)))))))))))))).))..)))).))))).)))))))))))))......(((..(((((((..(((.......(((..((((....))))..))).)))..)))))))))).)))))).)))))))))))))...)))).))))...)))))).)))))))..))))..)))))))))))))))))))))).).).))))))))).)).))..)))))))))))..)))))))))).(((.((((((((((((.((..((((..(((((((((((......))).(.((((....)))).)))))))))..)))))).)))))))...))))).)))........)))))))))).))))))))....(((((......))))).))))).))))))...)))))).)))).)))))..))))))))).)))..))))).....)))))).....(((......))))).)))))))..)))).))))).)))))))))))....((((((....((((.((((.(((((((((((.((((..((....((((((.((((...(((.........))).)))).))))))(((....))).))..)))).)..)))))))))))))).))))(((.(((((.((.....))))))))))(((((...))))).(((((((((((((..(.(((...((((((((.((((((.(.((......)).).)))).)).))(((.......)))((((((.((((((((.((((.....((.(((((.(((((((((((((.....(((((((.((((....(((..(.(((.((((..(((((.((((..((((((((........).))))))))))).))))).)))).))).)..))).(((((((((........))))))).)).)))).)).))))).(((..(((((((...))))))).))).....((.(((((((((((((..(((((((((((.((..((.(((((((((....(((((((..((((((.(((...))).))((((((((((((((((((.((((...(((((((..(((((((((((.(((((((((......((((((...........))))))...)))).))))).))))).....))))))..))))))).....))))))))))((((((((......................)))))..)))..)))))))))))).....((((....))))....(..((((((((((.(((.((...(.(((((.(((..((.......))..))).))))).).)).)))))))))..))))..).))))..))))))).(((((((.(((((..(((.((.((((((.((((.(((((...((((((((((((((..((((.((((.......)))).))))..)))...)))))))))))...........((((.(((((........))))).))))...))))).)))))))))).))..)))...))))))))))))((((((.....((.......)).....)))))).......(((((((((.((......)).))))...))))).))))))).)).))..))..)))))))(((((..(((......)))...)))))..(((...)))((((.((...)).))))..))))..)))).....))))))))).)))))))))))))))))))).))(((.((...((((((.(((...(......)...))))))))).))))).))))..)))))))).))).)))))))))....))).)..)))))).)))))))......((.((((...((((......)))).)))).))))))))........(((((((..((((.....(((((.((((...((.((.((((.......)))).))))..))))..)))))....))))....))))))).))).)))).)))))))...((((((((((((........))))))...))))))...(((....)))..)).))))))))))))....)))...((((.((((((((........((((..((........))..)))).((((((.((.((((..(((((...))))))))))).)))))).........(((.(((((((((...(((((((((((.....((((.......))))...))).)).)))))))))........((((((((((.(((.((.((((((((.(.((.......)).).))))))).((.(((((........)))))))).)).))).))))).))))))))))).)))((.((((((.(((((((.(((........((.(((.(((........))).))))).((((....))))(((((.(((...(((....)))))).)))))....((((....))))......((((((.......((((((..((((........))))..))..))))......)))))).........))))))).))).)))))).))(((((((((((((((.((((((.((((((............((((.......)))).(((((((((((((((((((.((.....)))).)).)))))......((.((.(((((((((((((((((((((....((((.(((((....).))))(((((((..((((((((....(((.((((.(.(..((((.......)))).).).)))).)))...))))))..))..)))))))............(((((.((((((...)))))).)))))..............)))))))))))))))))))).)))))...))))..(((((((((((((((((((((..(((.........))).)))))).)))))))))).))))))))))))))).(((((((((.(((....)))....)))))))))........(((((.((((((..........)))))).)))))...)))))).))))))((((((((((.....).)))))))))(((....((((.....))))....)))(((((.(.(.....).).)))))....(((((.......)))))...)))))))).....((..(((((((((.........)))))))))..))...)))))))...........))))))))..))))..
Thermodynamic Ensemble Prediction
,.(((...,((.((((((((((,({(((((((.((((.((((((((...((((((.(((((.((((((({{(((((((.(((({((((({{((.{((((((((((((,,,,,.{{.((((((((((((((.(((((((.....((((((((.(((((({..(((((.((({{((,,(((,..{||||||{(((....(((,.(((((..({(((((((((((({....}.)))))))((((((..((((((.(.....).))))))))))))))))},}}.))))),}|({{{,{{,,|||{((((((((((.{(...{{.{,,,.,,|,..,..}}....((((((((,{..(((((.((....)).))))}..}||.....}}}..)))))))))}.)))))))))))))})))}..,})))}}|,.........((((((.((((((((.(((.(((((({((.(.((((((((.((((((((((((....{{{{..(((((.(((((((....((((.(((((.(((((((((((((.(({{....||||{{(,,{{,,,...,.....,))))),|{{(....,,.||||.,,,,({((((((((...(((....))).,.((((.(((.((((((.(((.(((..((((((((((((((({((,({...,.,}},|||},,....,{{{{{||,.|||,....{{{,,.(((((((((((.(((((((....))))))).))))))}..,)))),)),,}.,}...}}))))}}...))))))))))))).))).))).)))))).))).)))).}.....({.{(({((({...((,((((.{{{{{{..,.{{{{{{{.|{||,,.........,.})))))).}))),,..))))))}}}}.||{,.,,))))),.}).)))))))))))))}}))))))))...))))).))))..))))))).)))))..||||,.....,,||.((((((((({{{(({.{,..(({((({..|,,,|,({.{|||..,{||.,},,},|.}|}}))})),....{|||||(((((((.,......)))))))...{(((.((...(((((..(((((((((.((,((((((,,(((((((((.....))).))))))).)))))).))...))))))))).)))))...}).)))}.....||.{{{{{,(((......))).},,))))){{((((((..(((((.(((......))))))))))))))})))))),..))))))).}}......})))))}}))))).))))...{,{.....}},...)))),},..}}.).))))))....))).)))))))}).))))))((((((,((((((((.((((.((((.((.....,))))).).))))))))).....,})).)))))).))))(((...)))..))))))))})))))).))))))))...,.....((((......)))))))))))....})})))))))))..)))}))},)))})))).)}),)))))){{{{.||,|{(,,.,,|||}|,}}}},,.|||||,|||.((((((((((......)))))))).)).}))))))}))))))))))))))).....(((((((.((.(({{{(,,..,,{{{.,.,..({{{{..{|.{{({|{|.,(((,,..|||..(((((((((.{{((,...}}}}.,,......((((((..((((((((.(((.((((..,,(((((((((((((.(((.....))).))))}}))))))))...((.((((......)))).)).{(((..((((.((.(((((.((,(((((((.((((((((.{((((...))),,})))))))).)))))))})..)))))....}).))))..)))),,.)))).)))))))))))..))...))))(((((((((.((((((..((((((.(((((.((((((.(((((((.....))))).)).))))))({.((((((.((((({{((({(((((.((((.(({.((((.....(((.((...)),))})))).})).)))).)))))...((((((((((..((...(((((((((((.((((((,(((...|}}(((((({{(({...........}))))))))))))))),)}...(((.....))),{..{.{{{(((,({({{(((({{(({{((.((((...((((((((((((..((((.(((((((((....(((.((((((..(((((.(((((((..((,{((((.((............)).)))))))...})))).)).)))))..))..)))).)))..(((((((((,({((.(((((........))))),).))}..)))).))))){(.(((((,(.(((((((...(((((((((..((((((((.....))))).(((((((..((((.....))))..))))))).})).)))).)))))))))))).}.,.)))))))((((.((((....((((((((..{((((.((((((((((((({.,......}.)))))))..........((((((.....)))))).....(((((((((((((..((({{(.((((...((((((.({....))...)))))),((((((((((((..{{.,..{{{{,.((((((....,.(((....))),.,.,.}})))|{{{{.|,,,...{,,|}},,||||.........((((((((((.((((....(((((((...((((((((((({.....})))))..)))))).{((..(((((((((({({..,,,(((((((,{,.{{.((((((.......(((((((....)))).))).},.,,.(((((...(((((({(({{(((((({{,|{({,|,(((((((.,.....))),,))),|.,|,|.{||||..|||.,.|{,(((((..{{.{{{(....))||,|}{||{.,,,,.}))}.,))),,,},,.,..,,))).))})))...))))){||{(,.(((((.((((.....{.(((((((....))))))).))))).)))))......{(((((....))))))))))}))))))..((((((.((((..(((.{{{(((...({....{(((.(((((((.(((((((.{.,,...,,).)))))))...))))))).))}..,,,}})},.,,,..)))..)))).)))))))),,.)))))))....,,,.,)}))))))))))..)))...)))))))))))....))))..)))))).)},)))))),)}))..)))))))))))).....(((((((((((.{....}.)))))))...)))).((.((((((((((((((.((((((,,(..((({((((({((,((((((,(((((...))))).{|||((....)),)))}|||||||}|,||}.,|,,||||||,((({(,,,,..}|||},(({(((,.{((((((({(((({{.}}|||{.,,..|||{,|||,|||||(({(({,{({{{((({{(((((,{{(((,(((({{(,(.,,,,|{|||.||||||,((((,((,,.,,,,,,{|||||,((((((.((((((.((((((((((...(((....))).))))))))))...))))))))))))((((({,,((((...((((.(((((....)))))..)))))))))))))).((((.(((((.((.(((....))).))...))))).))))..||.|||({(({((..({{{.,((.(((((,((,((((({.((((.,((.,,,,|,|....,.,}},)}},)))}.}}.)))))))}}}}.,{{(((((((((,.(({...(((((.(({...(((.......))).,|)).)))))....}))..)))))))))}|,.((.(((((((((((((...((((.....((((...)))).))))..))))))))))))).)}{((....))}|,||,..{{|||{{|{(||,.({{{{||....,}}||||.,(({.{{({{..,,(({(((,((((((.((((((((((((((((((,,,.||,{{{..(((((((((((....))))))))).))..)))||....{{{{..,,..,|}}}{{{|.||.{(((((((....)))).))))}})}}})}})))))))))))))))))))))(((.(((((...((((((((.((((.....))))...(((..((((.......})))..))))))))))).))))))))||||||,|,.{{{((((((((((((.{((((({{{((((((((.(((((((.((..((.({...}).))..)).))))))).)))))){{{.(((((,,.,|||||,,,.||,,|(({{{,|||||||||,||||{|||||.....,,,||}}}|.{{{{||{{|{{,..(((((((((({((((((((((..........))))))))....}))).,)))))))))).}|||||||||||||..((((({......}))))))))).}))))}}.....))))))))).).))))),,,)})))))}....))))}),,,)))))))))})).....))}||||}||},|}|||}},,)))...||{{|}..,)))))))}}}}}}|.}}},,))))}}}})))))))}.}||,,,,|}||||||.||||||||||,{||||{{{((||,|||||,,|||}|||}......,,}},,,.,,....,|||.|,|,.,.,|||||{,.((((((.(((((((...({.{(({{{{,,,)),.,}}}.}.}}.,,))))))).)))))),,.}}}.|,{(((|...})))}}))))).)))}|||||||,.|{||}|.||||||},||.,|)}|.}}),|)))|||))))}||}|||.((({{,,,{{|||||}}|{{,{{.,,,....))}}})}))))))))}||||..|({{|||,{,{{{,||,||||,|||,,.,||||}||)))}))))})))))))},))))},}||||||((((,((||.|{{.,,,}|||,.}||||||||{{{{,,,||,})}..})))...)}}}.})))}))))}.))})))))))),}}.)))))))))))))).))..)))).))))).)))))))))))))......(({,.(((((((..(((..{,...{((..((((....))))..)))})))..)))))))))).}))))).)))))))))))))...)))).))))...)))))).)))))))..))))..)))))))))))})))))))))).).).)))))))))})),},..)))))))))))..)))))))))).(((.((((((((((((.((,.{(((..(((((((((((....{{||,{{.,,{|...}))))})))))))))..)))))).))))))}..,))))).))).......,)))))))))).)))))))).,..(((((......))))).))))).))))))...)))))).)))).))))).,))))))))).)}}.,))))),,,..))))))....,||{.,..,,)}})).)))))))..)))).))))).)))))))))))....((((((....((((.((((.((((((((((({((({,.((..{{((((((.((((...(((.........))).)))).))))))||{...,))),))}},}}}.,..)))))))))))))).)))){{(,(((((.((.....)))))))}))(((((...))))).(((((((((((((..(.(((...((((((((.((((((.(.((......)).).))))})}.))(((.......))}((((((.((((((((.((((.....{(.(((((.(((((((((((((.....(((({{((((((,...(((..{.(((.((((..(((((.,,{,((((((((((........).))))}}))))..))))).)))).))).}..))),(((((((((........))))))).}),),))))))))))).(((..(((((((...))))))).)}),,,.{({.(((((((((((((..((((((({(((,((..,..,,|||||||,...{{{((((.{(((({{.{({,,.,}}.}}(((((((((((((((({{{((((...(((((((..(((((((((((.(((((((((..,...((((((...........)))))).,.)))).))))).))))).....))))))..))))))).....)))))))))}((((((((.....,,{...}}}........)))))..}))..)))))))))))).....((((....))))..,,(,,((((({{(({{(((,({...{,(((({.(((..({....,..}},,))).}))||.}.}}.))}||||||..}}}},,),)))),,))))))).(((((((.(((((,.(((.((.((((((.((((.(((((.,.((((((((((((((..((((.((((.......)))).))))..))}..,)))))))))))...........((((.(((((........))))).))))..,))))).)))))))))).))..))),..))))))))))))((((((.....{{.,...,.)},....)))))),,,..,,{({(((({{.{{,,....}).)))),..|||||.||}}})).))})).,)),,))))))){((((.,(((......))).,.))))}..|||,,,)))||{{.{{||.}).)))}..))))..)))).....))))))))),)})))))))))))))))))).}}(((,({...((((((.(((...,......}...))))))))).))))).))))..)))))))).))).)))))))))....))).)..)))))).)))))))......{(.((((...((((......)))).)))).)}))))))........(((((((..((((...,.(((((.((((...,,.((.((((.......)))).)),,..))))..)))))....))))....))))))).))).)))).)))))))...{(((((((((((.,....,.))))))...)))))}...(((.,.,))),.)).))))))))))}}....}}},..((((.(((({((({,,,.,,,((((..((......,.))..)))).((((((.((.((((..{((((...))))})))))).)))))).........(((.((((((,((.,.(((((((((((.....((((.......))))...))).)).)))))),})}.......((((((((((.(((.((.((((((((.(.((.......)).).))))))).{(.(((((,......,))))))}).)).))).))))).))))))))))).)))((.((((((.(((((((.(((......,,({.,,,.,,.,,{{,...}))})),}},{{({,.,.))|}|{(((.((({..(({....}}}}}}})})))},,.((((....))))......{{{{{(.......{(((((..((((........))))..))..))))..,,..)))))).,.,}}...))))))).))).)))))).))(((((((({{({{({.(((({,.(({{{{........,,..((((.......)))).(((((((((({((((((((.((,....)))).))}})))),,....||.((.(((((((((((((((((((((.,,,(((,.(((((....).))))({(((((,,({((((((....(((.((((.(,...((((.......))))...).)))).)))...))))))..},..)))}}))..,|},,,,...(((((.((((((...)))))).)))))........,,,,..)),,)))))))))))))))},)))))...))}}.,(((((((((((((((((((((..(((.........))).)))))).))))))))))}}}))))))))))))).(((((((((.(((....)))....)))))))))........(((((.((((((..........)))))).)))))...,}}|||,|}}}})||||(({(((.,,..},,)))))))}},,,,,,,{{{..,,.|||},,.,}|{(((({.{.{....,),).)))))}...(((((.......)))))...)))))))).....{{..(((((((({.{,.....))))))))))..))...)))))))...........}}))})))..))))..

Transcripts

ID Sequence Length GC content
GAGCCAGAGAGACGGCAGCGGCCCCGGCCUCCCUCUCCGCCGCGCUUCA… 8464 nt 0.6528
Summary

The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C-terminus of ER-alpha. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rat primary hepatocytes demonstrated that exposure to 10 ppm lead nitrate for 24 hours induced significant transcriptomic changes, identifying the FASN as one of 22 key molecular hubs, specifically upregulated and functionally coalescing in critical pathways including core metabolic processes, bile secretion, chemical carcinogenesis, steroid hormone biosynthesis, and cytochrome P450-mediated xenobiotic metabolism [Li et al. DOI:10.1007/S12011-025-04902-9]. In murine brown adipose tissue, single-nucleus RNA-sequencing revealed the FASN as a highly expressed marker for de novo lipogenesis in a specific lipogenic brown adipocyte subtype, whose identity is dependent on the transcription factor ChREBP [Behrens et al. DOI:10.1016/j.molmet.2025.102252]. A study in mice demonstrated that alcohol-induced alcoholic liver disease significantly up-regulated the FASN mRNA and protein expression, which was subsequently down-regulated by treatment with Gentiana dahurica Fisch ethanol extract, alleviating liver steatosis and damage [Cao et al. DOI:10.1016/J.Jep.2020.113422].