Basic Information

Symbol
FAU
RNA class
mRNA
Alias
FAU Ubiquitin Like And Ribosomal Protein S30 Fusion MNSFbeta RPS30 Fub1 Fubi Asr1 ES30 S30 Finkel-Biskis-Reilly Murine Sarcoma Virus (FBR-MuSV) Ubiquitously Expressed (Fox Derived) Ubiquitin-Like FUBI-Ribosomal Protein ES30 Fusion Protein Monoclonal Nonspecific Suppressor Factor Beta Ribosomal Protein S30 FLJ22986 Finkel-Biskis-Reilly Murine Sarcoma Virus (FBR-MuSV) Ubiquitously Expressed Ubiquitin-Like Protein Fubi And Ribosomal Protein S30 FAU, Ubiquitin Like And Ribosomal Protein S30 Fusion FAU Ubiquitin-Like And Ribosomal Protein S30 FBR-MuSV-Associated Ubiquitously Expressed Small Ribosomal Subunit Protein ES30 FAU-Encoded Ubiquitin-Like Protein Ubiquitin-Like-S30 Fusion Protein 40S Ribosomal Protein S30 FAU1
Location (GRCh38)
11:65120626-65122221
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Postmortem interval inference
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_001997.5
Sequence length
506.0 nt
GC content
0.5672

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-182.00 kcal/mol
Thermodynamic ensemble
Free energy: -192.34 kcal/mol
Frequency: 0.0000
Diversity: 84.57
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........(((((..((((((..(((.(((((.((....))))))).))).....((.((.........))))((((((((((((..(((((..((((((((.........))))))))..))...)))....))))).))).)))).((((...))))..))))))..)))))..((((((...(((.((((...((((..((..(((.(((....((((((((((.(((.((((..((((..(((..(((((((.....)).)))))..)))...))))...)))).)).).))))))))))......))).)))))..))))...)))))))...)))))).((((.....(((((((......(((.(((((.(((.((.....)).))).))))).)))..(((((.((((..((((.....))))..))))..)))))...........)))))))....))))((((((..........))))))..............
Thermodynamic Ensemble Prediction
.,,,,,{.(((((..((((((,((({.(((({({{....|}}}}}}.}}}.....{|,||,....},,,)),.((((((((((((..(((((..((((((((.........))))))))..)}..,)))....)))))}})).)))).((((...)))).,))))))..)))))..((((((...(((.((((...((((..((,.{((.(((....((((((((((.(((.((((.{(((((((((..(((((((.....)).))))),,,))}..}))).,.)))}})),).))))))))))......))).)))))..))))...)))))))...)))))).|||{|||..((((((({{{,.,(((.{((((.(((.((.....)).))).))))}.))}..(((((.((((..((((.....))))..))))..))))),,.,,.}}...)))))))....}}}|((((((..........))))))}.............

Transcripts

ID Sequence Length GC content
NM_001997.5 NCBI
CUCUUUCUCGACUCCAUCUUCGCGGUAGCUGGGACCGCCGUUCAGUCGC… 506 nt 0.5672
Summary

This gene is the cellular homolog of the fox sequence in the Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV). It encodes a fusion protein consisting of the ubiquitin-like protein fubi at the N terminus and ribosomal protein S30 at the C terminus. It has been proposed that the fusion protein is post-translationally processed to generate free fubi and free ribosomal protein S30. Fubi is a member of the ubiquitin family, and ribosomal protein S30 belongs to the S30E family of ribosomal proteins. Whereas the function of fubi is currently unknown, ribosomal protein S30 is a component of the 40S subunit of the cytoplasmic ribosome and displays antimicrobial activity. Pseudogenes derived from this gene are present in the genome. Similar to ribosomal protein S30, ribosomal proteins S27a and L40 are synthesized as fusion proteins with ubiquitin. [provided by RefSeq, Nov 2014]

Forensic Context

A study in humans demonstrated that the FAU was upregulated during short-term weight loss in subcutaneous adipose tissue [Bollepalli et al. DOI:10.1038/ijo.2017.245], and a separate investigation in human blood leukocytes identified the FAU as a highly expressed housekeeping gene exhibiting low variation across individuals with differing genetics, environment, age, and gender [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. A study in mice demonstrated that ribosomal protein (RP) genes, including the FAU, exhibited a rapid and widespread upregulation across various cell types with increasing post-mortem interval (PMI), plateauing at approximately 36 hours [Guo et al. DOI:10.1016/j.ijbiomac.2025.147708].