Basic Information

Symbol
FBXL3
RNA class
mRNA
Alias
F-Box And Leucine Rich Repeat Protein 3 FBL3A F-Box And Leucine-Rich Repeat Protein 3A FBXL3A FBL3 F-Box/LRR-Repeat Protein 3A F-Box/LRR-Repeat Protein 3 F-Box Protein Fbl3a IDDSFAS
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_012158.4
Sequence length
3506.0 nt
GC content
0.3802

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-932.60 kcal/mol
Thermodynamic ensemble
Free energy: -999.67 kcal/mol
Frequency: 0.0000
Diversity: 897.37
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(.(((((((((((.(((.(((((.(((.(((..(.(((((((....)).))))).)..))).)))....))))).))).........))))))))))).)..(((((((((((..(((((.((((((....))))))((((....))))(((((((.....((((((((((.......((((.((....))))))...)))))))))))))))))(((....))))))))((((.(((...))).))))......(((((.(((..(((((.((((((((((.(((((.....)))))))))).))(((((......)))))))).))))).......(((((((..(((((((((.((....(((....)))(((((((((.((.....(((((((...(((((((.............))))))).)))).))))).)))....)))))).)).))))).))))(((((((....))))))))))))))....))))))))...((((((((((...((......))...(((((((.....))))))))))))))))).((((((((.(((((((((.((.((((((((...((......)).)))).(((.(((((((((((.((((.............(((((................))))).((((((.(.(((....(.....)...))).)))))))((.((((((((...))))))))))((((((((((((((((......(((((...................)))))......((((((((...(((.(((.(((((((..((...((((((((.(((....)))..)))....)))))...))...)))))))))).)))...)))...)))))((((((((((((((....(((((((((.((.(((((.((...((((..((..(((((........)))))...))..))))))))))))))))).)))))....(((.(((.((((..........)))).))))))..(((((...)))))..((((....))))((....(((((((((....((((((.....))))))...(.(((((((...))))))).).....((((.((.....)))))).....)))))))))...))((((..((...(((((....(((((.....))))).....))))).......(((((((((((((((..........)))).)))).))))))).....))..))))...))))))))))))))....(((((......)))))(((((((......((.(((((.((..((((((...)))))))).))))))).......)))))))......))))))).)))))))))((((((....))))))...)))))))))).)))))...)))..........((((((((..(((....(..((((...(((.((((.((((...)))).)))))))((((((..((.((((((((.......)))....(((((.......)))))(((((((.((((....)))).(((((...)))))((((((((.(((......(((.((((((....))........)))).)))))).))))))))......((((((((.(((........)))..))))))))...(((((..((((((.(((((.((((((...))))))...((((((((((((((..((..(((...((((((((((..((((((((......(((((((......)))))))....(((((((((.(((((((.....(((((..((((((((...........)))))))))))))........)))))))(((..........)))......)))))))))((((((((..((.................))..))))))))..((((((((((..((.....(((((((......)))))))))..))))))))))))))))))..........((((((......))))))...(((((.((........((((((((((((((.(.....((((((.(((..((((((.......))))))))))))))).....).)))))))).)))))).......)).)))))))))))))))...)))..))...)))))).))))))))...))))).))))))..)))))..((((((((..(((((....((((((((((......(((((....(....)..)))))....)))).....))))))))))))))))))))))))))...((((((((((...................))))))))))((((.(((((((...........((((((..(((.....)))..))))))(((((((.((((((((((...(((((.................((((((((...........)))))))))))))....)))))))))).)))))))(((((((..(((((..(((.((((...)))).)))......((((((........(((((.(.....))))))........))))))((((((....)))))))))))..)))))))((((.((((((..(((((((((...((((((((((...(((((....((((((.((((........))))((((((((((((((((((..((........))..)))))))))......((((......))))......)))))))))....(((((...)))))...((((((((((((........((((((((((((..(((((((((((.............))))...)).))))).)))))))))))).........))))))))))))))))))))))).......))))))((((......))))....(((.(((((((((....))))))..)))))).(((((......)))))......)))).....)))))))))..))))))))))))))))))))).(((((((.((((.(.((.(((((......))))).)).).)))).)))))))......(((((((((((........)))..))))))))))))).))..))))))..))))..)....)))..))))))))........)))).)).))).))))))..)))).))))..((((....)))).....)))))))...)))).((((((((...(((((((((((.....((((((.((((((((...((((((((............)))))))).))))))))))))))................(((((.......)))))........)))))))))))...)).................((((((((.((...((((((((((...............)))))))))).)))))))))).........))))))...(((((........)))))..........
Thermodynamic Ensemble Prediction
...(.(((((((((((,(((.(((((.({,.{{{..{{(((({{,.}}})).|||}|,|,.,,,,})}}}}}))))),))}...,,....))))))))))).|{,,{{((((((,,..,||||}|(((((....)))))|((((....))))(((((((.....((((((((((....,..((((.((....))))))...)))))))))))))))))(((....)))||||}(((({((({{.}||{|}}|.{{{{,(((((.(((..(((((.((((((((((.(((((.....)))))))))).))(((((......)))))))).))))).......(((((((..(((((((((.((....{((....))}(((((({,(,(,....{(((((((...((((((({{.,....,,}..))))))).)))).))))}.})),...)))))).)).)))))}})))(((((((....))))))))))))))....))))))))...{{|||||{{{..,{||}..,}))...(((((((.....)))))))}}}|||}}}|,{{(((({({(((({,{{{,,{.((((((((...((......)}.)))).(((.(((((((((((.{{,,.,,,,........(((((................))))).(((((,,(.(({....{.....}...})).))))))){{.((((((((...))))))))}}((((((((((((((((......{((((.......,,....,...,.}}})).....{((((((((...(((.(((.(((((((..((...((((({((.(({....,})..)))....)))))...))...)))))))))).)))...))),..}))))|(((((((((((((..((((,..,{{,.((,(({{{.{{..,(((({,{{..{{{||,},,,...}}}}},,,}}..}}||||||||}}}}}}}{((((,{.,,(({{(((.((((..........)))).))},},..{{{({,,,|||||{|{|||.||.,||,{{....((({{(({{....((((((.....))))))...,.(((((((...))))))).}....,|||{.||.,...}}||||..,,,|||}}}})),,})},})|}.|,..,{{{|{....(((((.....)))))....,)))}),,.....{(((((({(((((((..........))))))))).))))))).,,,.))}}}})}}..)))))))))))))}....{((((......))))|(((((((......((.(((((.((..{(((((...)))))))).))))))).......))))))),..,..)))))))},))))))))((((({....})))))...}))))))))).)))))...))).....,....((((((((,{(((.,,,{,,({((.,,((,{((((.((((...)))).)))))),.,,,((({,,.||||.,,,..,,,..,||{,..((({,,,..,.{|||||({(({,({({{{.,}}}}))}|||||}||)))))||||({{{,{{{,,,...||{,|{||,,.,,,}},....,,}}))),)})}}|.}}}}}}}}......((((((((.,{{........,}}..)))))))),,.(((((,.((({((,(({((,({{{(({.,||}},,...((((((((((((((..((..(((...((((((((({..((((((((......(((((((......)))))))...,(((((((((,(((((({.,...(((((..((((((((...........)))))))))))))........}})}}}},,,....,,.,.,))),..,,.)))))))))|(((((((..((..,..............))..)))))))}..((((((((((..((.....(((((((......)))))))))..))))))))))))))))))..........((((((......))))))...,,,,,{(({{......|||||,{(((((((.{.....((((((.((,.{((((((.......))))))))})))))).....}.)))))))},|,|||,.......,),),,,,))))))))))...)))..))...)))))).))))))))...})))},))}))),.))))).,|||||{||..|{{{{....{,,{{{,{,{....,.{{{{{...,{,,,,|..}}}}}.,,,}}}}.....}}}}}}))))}))))))))}}}}}}}...((((((((((........,,.........))))))))))((({{(((((((.....{{{{{{((,,,..,|)))))).,}}..}}}}}|(((((((.{(((((((((.,.((((({{{{{{,,,,.,.....,{,,,,,,.......,...)))))))},})))....}))))))))).)))))))|{(((((..(((((..(((.((((...)))).)))......((((((........(((((.{.....})))))........))))))((((((....))))))})))}..)))))},((((.((((((..(((((((((...((((,,((,,...(((((....((((((.((((,,......|||}{{,,,{(({{((((((((..|{,,......)),.)))))))}}.,....,{||...,}})))|{{{{{.,,}))))))....(((((...)))))...{(((((((((((....,,,.((((((((((((..(((((((,(((..,..........,}},},,)).))))).))))))))))))...,,,,..)))))))))))})))))))))))|{{,...,)))),((((......)))){{.,({(.(((((((((....))))))..)))))).}|,,,......,,,,,....}})))}.....)))))))))..))))))))))))))))))))).{((((((.((((.{.((.(((((......))))).)).}.)))).))))))}....,(((((((({(((........))}..}))))))))),},,||||||||}},.}}|},.},..,))}..})))))))........)))).}},}))})))))},.,}.,,}}}},.{{{{....}}},.,,}})}))))|...{{{{...,{{{{,{{.{{({,..{{{{,,...((((((.((((((((..,((((((((............)))))))),))))))))))))))...,,))}})),,...,||{|||||,||}}}}}.,..,{{{,,,||}}}||||||||,,,||}}},,||||,..{{{{{{{{.{{...|{|||||{,,.,{,,,,,|,.,|,,}))))}}}}},|}}}})))))..,,,...,}}}}}},,}|||||,.,,,,,,))))),,},,..,,.

Transcripts

ID Sequence Length GC content
AGACUCGCUGUUUGUGGCCCAGGUGCAGGAAGCUUACGCGGUGGCAGCC… 3506 nt 0.3802
Summary

This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains several tandem leucine-rich repeats and is localized in the nucleus. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the FBXL3 as a differentially expressed circadian rhythm-related gene in sepsis patients versus healthy controls, with its expression validated by RT-qPCR [Wang et al. DOI:10.3390/ijms26093993].