Basic Information

Symbol
FCN1
RNA class
mRNA
Alias
Ficolin 1 FCNM Ficolin (Collagen/Fibrinogen Domain-Containing) 1 Ficolin-Alpha Ficolin-1 M-Ficolin Ficolin-A Ficolin (Collagen/Fibrinogen Domain Containing) 1 Collagen/Fibrinogen Domain-Containing Protein 1
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002003.5
Sequence length
7588.0 nt
GC content
0.4506

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2693.30 kcal/mol
Thermodynamic ensemble
Free energy: -2829.17 kcal/mol
Frequency: 0.0000
Diversity: 1851.33
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((((((((((.(((((((.(((.(((...(((((((((((((((((((((.((((.(((((.(((((((((.(.(((((..((((((((((((((...(((((((...((((....))))...((((....)))).((((((...(((((((((.(((.(((((((..(((...((((.((((((......((((((((((......)))))).)))).....))))))...))))...)))...)))).........((((((((.(((.((((((((..........)))..))))))))..)))))))).((((....((((....((((((.(..((((..(((((((((((((((((((((.((.....)).))))..))))...)))).((((((.(((((((....))))...)))))))))..((((((((((..(((.((((((((((((..(((...((((((.......))))))))).))))))))).........))))))))).)))))))...(((((........(((((((((((......((((..((((..((((.((((..((((((.(((((((((((((((((((.........((((..((((((((.(((.((.....))))).)((((((.((((((...(((....)))))))))))))))..........(((((...)))))((((((((((.....(((((......)))))....))).))))))))))))))..))))...(((((..(((((..(......(((((((.(..((((.((((.....(((....)))....)))).)....)))..))))))))....)..)))))...((((.((...((((.(((((((.(((.....)))......(((((((....))))))).(((((....)))))......))))))).))))..)).))))....(((.((...)).))).)))))....(((.(((((((......)))))).).)))..((((((((((..((((.(((((.........))))).)))).))))).))))).))))......))))))))))))).)).)))))))))))))....)..)))).))))......))))))))...))))))))))))))...((((....)))).((((......))))..........((.(((((((...............))))))).))((((((...)))))).((((((....))))))..((((((((.(((((...(((((((((((((((((..((((((.((((.(..((((.((....)).))))..)...))))..))))))..))))))))))......))))..)))((((........))))..))))).))))))))))).))))..)))))))))))....))))......)))))).))).))).)))..))))))....)))))))...(((((....((.(((((...................(((((((.((((....((((((((((((.......(((.((((.......)))).)))((.((.(((((((((((..........(((((((......)))))))....))))).)))))))).)).)))))))).))))....)))).)))))))..........((((.....))))))))).)))))))..))))))........))))))))..))))).))))((((((((...)))))))))))))).))))).((((....))))..(((((.(((..((....))..)))...)))))...).))).))))))))........))))))...((((((((((((((((((.((((((......(((((((((((.((........(((((((..........((((.....)))).)))))))...(((((((((.....((((..((((......)))).))))((((.....)))).(((.....)))((((((((((((((....)))))..)))...))))))....)))))))))((((((.(((((...((((((((...((......))...))).......(((((((.(.(((........))).))))))))))))).)))))....((.....))..........((.(((((((((...(((((((((((((((((((...((((((((.((((((....)).))))...))))))))((((..(((((....))))).)))).))))..((((((((.(.(((...(((((.(((((................((((((((((.((((..((((((((((((((((((...((((.(.(((..((((((..(((((((..((((((.((((..((((((((.....))))))))))))))))))...))))))).......(((((..(((((((((.....((((.((((...((((......))))..))))...))))..........))))))))).))))).......((((((((..((((((..((((.((((((.................))))))..(((((........)))))(((((((((..(.(((...(.(((((((..(((((.....(((((...)))))...........(((......))))))))...))))))).))))..)..)))))))))...))))..))..((((....))))......((((((........)).))))))))..))).))))).(((.(((.....))).)))..))))))))).)))))))))))))))(((.((((((((.(.(......).).).)))))))...)))........))))))))..)))).)).......((((((((((..((((((((.((..(((.((.((((.((((.....((.(((((....)).))).))..))))))))...((((((........((.(((.(.(((.......))).))))..))........)))))).((.......)))).)))..)))))))))))))...)))))))...........(((((...)))))........((((.......))))..((((((((..(((((.....((((............((((((.(((((.(((((.((((((......((((((((((((..((.(((((....((...((((((.((((....(((((((((((.((.((((((.(((.(((((((...((((.((((...(((..(((.(((((.....(((((((.................))))))).))))).))))))...))))))))..)))))))........)))..)))))).)).))))))).))))((((((.......(((((((.....))))).....)).......))))))((((....))))..((((((.....)))))).))))))))))....)))))))))....)).))))).))))).....)))))).))))))))))))))))...(((..((..(((((....))))).))..))).(((((((....))))))).......(((((((((..((((...))))..))).)))))).....)))).....)))))..)))))))).((((.((((.(((((((((.(.(((((((.(((((...(((((((((((((((((((((((((((((((((((((((((((((((((((((.((.(((((.((((.((..((....((((((((......))))).....)))...........(((...)))....((((((((((((((((((((.(((((((((.((((((((((((((((((((((((((((.((.((((((((((((((((((.((.((((((.(((.(((((.(((((((((((((((.((((((((((((((........((((..(((((((..(((((..(.(((((((((.(((.(((((((((....((((((.(((((((((.......((((..((((..(((((((((((....((((((((..(((((......((....((((....))))..))....)))))..)))).))))..)))))))...))))..))))))))..((.....))........)))))))))))))))....)))))))...)).)))..))))))))).)..)))))..))))))).))))((((((.(((..(((((..(((...((((((((.((((......((((.....))))))))..)))...((((((((........)))))))).............))))).....))))))))..))).))))))...(.(((((((.((((..............)))).))))))).)...((((((((......((((..((.((((((((((.........)))))))))).)))))).))))))))..((...)).)))))))))))))).))))))))))))))).))))).))).)))))).)).)))))))))))))))))).)).)))))))))))))))))))))))))))).))))))))).))))))))))))))))))))....))..)))))).))))).)).)))))))))))))))))))))))))))))))))))))))))))))))))))))...))))).))))))).).))))))))).)))).))))..................))))))))...))))).)))))...))).)))))))))....)))))))))((((((..((((..(((((((((((((((.((((((..((((.((((((((.(((((.(..((((((((..(((..(((((((.(((.(((((((((((((((((((.((((((((.((.((((((((((((.((....))(((..(((((((((.((((((.(((((((((.(((((((((((((((.((((((((.(((((((.((((((((((.((((((.((.(((((((((((((.((((((((((((((((((((((((((((((..(((((((...(.((((((.(.((((((...(((((((((((.((.(((((((((((((((((((....(((.(((((((((..(((((((.(((((((.(((.(((.(((.(((((((((((((((((.(((((((.((((((((((.((((((.(((((((....((((((.((((((((((((((.((((((((((((((((....((..(((((((.(((((..(((............)))..))))).))).))))..))..)).)))))..))))))..(((.(((..((((((((((((((((.(........)))))))...........)))).))))).)..))).)))(((((............)))))....((((....))))((((........))))........................)))))))))))(((((.............................)))))))))))))))))..))))))).........(((((...(((..((((((((((....((((((.(((....))).)))...................................((((....((((...............))))....))))((((......(((((((((((.((......((((.....)))).....))...))))).))))))....)))).)))....)))))).))))..)))...))))).............................................................(((((((((......)))))).)))......................................)))))).)))))))))).))))))).))))))))))))))))).))).))).))).))))))).)))))))..))))))))).)))....))))))))))))))))))).)).)))))))))))...)))))).).)))))).)...)))))))))))))).))))))))))))))))))))))).))))))))))))).)).)))))).))))))))))...))))))).)))))))).))))))))))))))).))))))))).)))))).)))))))))..)))((((..(....)..))))((((((((((((((((..(((..................)))..))))))))....(((.((.(((((((...))))))).)))))))))))))...............))))))))).(((((((....)))).))).((((((((..((((((((((.....)))))))..((((((.(((((((.(((((((........))))))).)))))))...(((((((...........)))))))......((((((.((((...))))))))))((((.((((((((.............)))))).)).))))((((((...)))))).........(((((.......)))))...)))))).......))).)))))))).......))).)).)))))))).))))((((((...((..((((....(((........))).))))))...)))))).....(((((...)))))..........))))))))))))....(((((..(((.....)))))))).((((.....(((.........((((........)))).......))).....))))........((((((((........))))))))......((((((.(((........)))))))))...))).))).))))))).))).))))))))..).)))))..)))))))).(((..(((.(.((.((.((((..(((....))).)))))))).).)))..)))...)))).)))))).)))))).)))))))))..))))..)))))))))).)).)))))))))..)).(((((((((....)))))))))))))))((.((((((..(((((..((.(..((((.....((((....((((......))))....)))).....)))).).))..)))))..)))))).)).)).)))))))))))..)))))).)))).....)))))))))...........(((((((((...)))))))))..((((((.(((((((....((....))...))))))).)))))).((((.((((.(((((....))))).)))).)))).............(((((.(((.....))).)))))..)))))(((((((...))))))).........)))))))..))).))).)).))))).)))))...............((((((......))))))..))))))))....
Thermodynamic Ensemble Prediction
....(((((((({((((,{{{{|||,|{,.((({.{((((,,{{(((((,,{(((((((,((,,(((({(((((({,{.,,||||(,.{{((((({{{,{{,...,|||||||,.({((,,,.,}||{..((((....)))).,||||{..}|||||||||}|||.,||||||,.{,|}}}|,{|.|||||{..|||.{((((((,,,.}}},}))))||{||||{{{{{||||||,..||||,..}||{{{||.|{({,{...{(((((((({((({((((((((,,,{{.,,..,,,.,|||,||||{{|,,|||||,(({(....(((({,{.((((((.(..((((..(((((((((((({((((,((({({,....}},))))}.})))...))}).|(((((.(((((((....,)))...))))))))}..{{{{{{{{{|,}||{.{{{(((((((((..((({..((((({.......))))))))).))))))))).,,,,,.,,|}}}))))),)))}}||{..(((((.,......{((({((((({.((,...,,({.((((...(((.((((..((((((.(((((((((((((((((,,.........((((..((((((({.((,,((.....))))).}(((((,{((((((.,,{,,..,,,,,))))))))))))..........{({{,...}))),((((((((((.....(((((......)))))....))))}}))))))))))))..)))).....,{{..(((((,.(......{{((((,((,,((({.,{{{.,,..(({....}}}..,.}}}}.}..,,))}..)))))))},...},,))))),},((((.((..,{(((.(((((((.{{(.....|||......(((((((....))))))).{,{((|||.,})))......))))))).))))..)).)))).....,,,{,....}})},.,}}}}.}},|{{.{((((((......)))))).).}))..((((((((((.,{(((.(((((..,....}.))))).)))).))))).))))).)))}.,.,..))))))))))))).)).)))))))))))))....}}}))},.,,))).},},))))}))}..,}}}))))},)))},...((((....)))).{(((..,,,,|}}}.,},,,,.,,{{.{((((((..........,..,.)))))}}.|,((((((...)))))),((((((....))))))..((((((((.(((((..,({(((({{(((((((((..((((((.((({,{..{{{{.{{..,.)}.}}}}..}...})))..))))))..))))))))}|......}})}..}}}((((........)))),.))))).))))))))))).))))..)))))))}}}}....)))),,}}})))),,,.,))}),),},,....,|||{...,,,,))),..,||||.}}}||}|{|||,................,{(,((((({((((....,||||||||||,|||.(((((((,((.((((((.{{{{,|||((|((|(((({((({{{..........{{{{{{(,.,,,,|}}})))}},})),))})))))},|,}}.}}}}}},}.}}}}....}|||{|||||||{.........((((.....))))|},||.|||,}},.,||||||...,{{..,},,||||,.}}|||,,,,.((((((((...))))))))}))))},)))),,|{(({...,)))..(((({.(((..({....})..)))...}))))...,.}}}.))))}}}}.......,})))))}}}}..}}|,,||.|,{,..|||,.,,,.|||||||||,(((((((.{........(((((((..........((((.....)))).))))))).,,({(({(,,{....}|,})))||{{......}}})..,),))).)))){|||((((({((.(((((,,,,||||||,||,}}}))))))),)))}})))))).}}.}))))))||}||}}}}|||||}}}|||||||,,}.||}}}}}},,,,})))}}|{{{.,{||||{.(,(((.....,{{|}}.|||}}}}}})),)})},,,..,.}}}))..}))))...||||||{(((((((((...{{(((((((((((((((((...((((((((.((((({....,}.))))...)))))))|{(((..(((((....))))).)))),)))).,((((((((.(.(((...(((((.(((((.....,.{,..,....((((((((((.((((..((((((((((((((((((...((((.(.,{,..((((((..(((((((..((((({.((((,.(((((((,.....})))))))))))))))))...))))))).......(((((..(((((((((.....{{{{.((((...((((......))))..))))...,}}}..........))))))))).))))).......((((((((..(((({{..((((,((((((.................))))))..{((((........))))}(((((((((..(.(((,..,.(((((((..(((((.....(((((...})))).,.........{((......))})))))...))))))).))))..)..)))))))))...))))..}}..((({....}}}).,,...((((((........)).))))))))..)))}})))).(((.(((.....))).)))..)))))),}},,)))))))))))))){{,.(((((({,.{,(,......,,.},)))))))...,}}........))))))))..)))).)),.,,...((((((({{{..((((((((.((..(((.((.((((.((((.....((.(((((....)).))).))..))))))))...((((((........,{.(((.(.(((.......))).))))..)}........)))))).((.......)))).)))..))))))))))})}...))))))),||........,{{{{.,.,,,}|.,,,{{,.((,,.},,,,,)))}.,||{{{(((,,(({((,,,{{(,({{...........((((((.{{({(.{(({(.((((((......((((((((((((.,((.(((((....((...(((((,,((((....(((((((((((.((.(((((({(((.{((((((...((((.{(((.,.(((..(({.((({,.,,..(((((((.................))))))).))))).))))))...)))}))))..))))))}........))).,)))))).)).))))))).)))),(((((.......,,(((((.....))))).....}}.......)))))|((((....))))},{(((((.....)))))).))))))))))....))))))))).,..)).)))))},)))).....)))))).}}})))))))))))))...|||..,,..|||.}},,,,}))).})))))}.(((((((....))))))).....,,{({{,{{{...{{{...,}}},.,}}},}))}}},,...},},.....|}}||,.,}}))))),{{({,{(((.(((((((((.(.(((((((.(((((...(((((((((((((((((((((((((((((((((((((((((((((((((((((.((.(((((.(((({(,..((....,,.,,,,{,,,.{{||||,.....{{,........,..}}))}})).....((((((((((((((((((((.(((((((((.((((((((((((((((((((((((((((.((.((((((((((((((((((.((.((((((.(((.(((((.(((((((((((((((.((((((((((((((......{{((((,.(((((((..(((((..{.{{(((((((,{((,({(((((((....((((,,{(((((((((......,{{{{,.{{{{..{{{{(((((((....((({((((..(((((......((,,,.((((....)))),}),....)))))..)))}.})))..)))))))...}}}|.,||||||||,,((.....||,,,,,..,}}}}}}}}}}}||}}.,,.}}}}}||,..}}.})),.}))))))}),}..)))))..))))))).|}}|(((({{.{{|..{((({.,{{(,..{{{{{((({((((,....,((((.....)))))))).}))),,{(((((,{,.,||||,.)}}}}}}}....,,.......)))}}.....)))))))}..))).}}))))},.,.{((((((.{(((..............)))}.))))))}}},,.{((({{{||||||,||||,.|(.((((((((((.........)))))))))).),,,}},)))))))),.}},..,,.)))))))))))))).))))))))))))))).))))).))).)))))).)).)))))))))))))))))).)).)))))))))))))))))))))))))))).))))))))).))))))))))))))))))))....)).})))))).))))).)).)))))))))))))))))))))))))))))))))))))))))))))))))))))...))))).))))))).).))))))))).}))),}},....,.,}.,},.,.....,},))}},...))))).)))))...))).)))))))))}...))))))))){{((((,,((((,,((((((((((((((({((((((,{((((,(({(((((.(((((,(,,(((((((({(((({{((((({({(((,(((((((((((((((((((,((((((((.((.(((,{(({,((({{({(({(|(((..(((((((((.((((((.(((((((((.(((((((((((((((.((((((((.(((((((.((((((((((.((((((.((.(((((((((((((.(((((((((((((((((((((((((((({{{{(((((((...,.((((((.(.((((((.,.(((((((((((.((.(((((((((((((((((((....(((.(((((((((..(((((((.(((((((.(((.(((.(((.(((((((((((((((((.(((((((.((((((((((.((((((,(((((((,...{(((((.((((((((((((({,(({||||||{{{{{{{....,,..(((((((.(((((..(((............)))..))))).))).))))..|||,|||}}|||.{||||||..,((.(((..((((((((((((((((.{........,))))))..{|,....}})))).))))).)..))).))}(((((............)))))....((((....)))){(((........)))),,,,,,,...........,.....}}}}}},,,,}{{{|{,,,..........................)))))))))))))))))..}}))}},.........{((((...(((..((((((((((.,,,({{(((.(((....))).))),,..,,,.........,{{{...............))))....,(({...............,,,,........{{{{......(((((((((((.{....,,,{(((.....}))),...,)}...))))))}})))).,..)))}.}}}....)))))),,)))..)))...))))}.........,.....,},...........................................(((((((((......)))))).))).||...............................,,..}))))).)))))))))).))))))).))))))))))))))))).))).))).))).))))))).)))))))..))))))))).)))..,.))))))))))))))))))).)).))))))))))).,.)))))).).)))))).,...)))))))))))))))))))))))))))))))))))))).))))))))))))).)).)))))).))))))))))...))))))).)))))))).))))))))))))))).))))))))).)))))).)))))))))..))){{{{..{....,,,|}||,{|{|}||||,(((({...,,,))}}.........,{((((((((((({.{{{{{{((,.,,.{(((((,.,.}}}}}||{||||{||||....}}}}}}..}}}}}},},,.}}})}}}||.,|}}}}}).))))))......,))))))}|((((({.....||||}}...{{||||,||{((((.(((((((........))))))).)))))}|,{{{{{{,,,...........,..,,}},,....((((((.((((...))))))))))((((.((((((((.,,,...,,,...)))))).)).))))((((((...)))))),.{,{,,....})},}}}}}}))))},..)))}))...,............,)))).}}..))).)).))))))))}))},((((((...{(..((((....(((........))}.))))}}...)))))).....(((((...))))).......,}}))))))))))))....{,(((({((({{,..||.,,,))...}}}.,}}}}...,,,....{{({...,,...||||{{,.{{{|....}}}}}})}....,..((((((((........))))))))..,...((((((.(((........)))))))))...})))))}.))))))).,)).))))))))..).)))))..)))))))).{{(..(((,(,{(,(..((,({{(((....}))}))),))}}),.)))..)))...)))).)))))).)))))).)))))))))..))))..)))))))))),...))))))))}.,..{(((((((((....)))))))))}{{|{{||,||||((..{,{{{..||,,},{{||,.,,,{{((,.,.{{{,,,,,..||}}||..}}}}.,,,,)}},...,|,.}}}||..}))))).}).))))))))))))))).))),.....{{{{{,,{(((((((((..{{((((,...|))))}}......,|||....,{|||{.,{((({(,,,,((,...}}...}}})))),)))))).|||..((((.(((((....))))).)))).,{{((((((,,......,((((.(({.....))).))))))))))))(((((({...})))))).)))))))))))))))}.)}}.|)).)).}}}}}.})}||,,.........,,,|||{{,,.....}))))))..))))))))....

Transcripts

ID Sequence Length GC content
GUUAGAGCUGGGGGACUCUUCAGAGUCAAAGGCCAGAGAGCAUGGAGCU… 7588 nt 0.4506
Summary

The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the FCN1 is a monocyte marker used for cell type identification in peripheral blood mononuclear cells from elderly hip fracture patients, where it was applied in single-cell RNA sequencing to delineate immune cell clusters [Lu et al. DOI:10.1186/s12979-023-00380-6]. A separate microarray analysis of thermally injured human skin found the FCN1 was significantly up-regulated as an inflammatory/immune response gene in burn wounds compared to normal skin across multiple post-burn time periods [Greco et al. DOI:10.1016/j.burns.2009.06.211].