| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCACUUGCCAUUUCUCAUAACAGCGUCAGAGAGAAAGAACUGACUGA… | 513 nt | 0.3860 |
This gene encodes a small secreted protein that is expressed in follicular dendritic cells. This protein specifically binds to activated B cells, and functions as a regulator of antibody responses. It is also thought to contribute to tumor metastases by promoting cancer cell migration and invasion. [provided by RefSeq, Dec 2011]
A study in humans demonstrated that the mRNA marker FDCSP is a saliva-specific gene, as a novel RT-LAMP CRISPR-LFA assay detected its expression exclusively in saliva samples (7/7) with no cross-reactivity to blood, semen, or vaginal fluids [Su et al. DOI:10.1007/s12024-025-01079-4].