| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUGUCACCCGCGGUCGCUUCGGGCGGGGAUCGGUGCCACCGAGCGCAA… | 1406 nt | 0.6679 |
This gene belongs to the ETS transcription factor family. ETS family members have a highly conserved 85-amino acid ETS domain that binds purine-rich DNA sequences. The alanine-rich C-terminus of this gene indicates that it may act as a transcription repressor. This gene is exclusively expressed in neurons of the central serotonin (5-HT) system, a system implicated in the pathogeny of such psychiatric diseases as depression, anxiety, and eating disorders. In some types of Ewing tumors, this gene is fused to the Ewing sarcoma (EWS) gene following chromosome translocations. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.