| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAUCCUUUCUUUCAGCUGGAGUGCUCCUCAGGAGCCAGCCCCACCCUUA… | 3654 nt | 0.4327 | |
| AAUCCUUUCUUUCAGCUGGAGUGCUCCUCAGGAGCCAGCCCCACCCUUA… | 2209 nt | 0.4726 |
This gene encodes the alpha subunit of the coagulation factor fibrinogen, which is a component of the blood clot. Following vascular injury, the encoded preproprotein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia, afibrinogenemia and renal amyloidosis. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that undergoes proteolytic processing. [provided by RefSeq, Jan 2016]
A study in humans demonstrated that the FGA locus, part of the CODIS STR panel used for human identification, remains a challenge for accurate genotyping using Oxford Nanopore Technologies long-read sequencing, as its analysis is more difficult compared to other STR loci like D13S317 or D5S818 [Ferreira et al. DOI:10.1016/J.Fsigen.2024.103156]. A study in human blood plasma from 103 individuals demonstrated that the FGA was significantly upregulated with age and contributed to a proteomic age-predictive model achieving an R² of 0.59 ± 0.02 [Salignon et al. DOI:10.18632/aging.204787]. In a separate investigation of human serum exosomes from septic patients, the FGA was consistently upregulated during sepsis progression and was associated with coagulation cascades [Li et al. DOI:10.1016/j.jare.2021.11.005].