| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGAUGAGGUUGAGGUUGGCCCACGGCCAGGUGAGAGGCUUCCAAGGC… | 1347 nt | 0.5650 |
Theis gene encodes a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes. This protein is a secreted endocrine factor that functions as a major metabolic regulator. The encoded protein stimulates the uptake of glucose in adipose tissue. [provided by RefSeq, Mar 2016]
A study in humans demonstrated that serum levels of the FGF21 were elevated in heavier monozygotic twins within an immunometabolism component, consistent with its known elevation in insulin-resistant morbidities like obesity and type 2 diabetes [Kibble et al. DOI:10.1098/rsos.200872]. Another human study in monozygotic twins discordant for BMI found serum levels of the FGF21 were strongly correlated with serum Angptl4 levels, with both proteins sharing common genetic and environmental factors [Robciuc et al. DOI:10.1194/jlr.P015867].